Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-124-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
123902-123916
0.010
12
7mer
131581-131606
0.010
9
8mer
149580-149596
0.009
2
8mer
226629-226641
0.009
2
7mer
238936-238945
0.007
2
8mer
208802-208814
0.006
2
6mer
436-457
0.006
3
7mer
196799-196825
0.005
2
7mer
87792-87811
0.005
2
7mer
175754-175764
0.005
2
7mer
176453-176467
0.004
2
7mer
198291-198300
0.004
1
7mer
47971-47982
0.004
2
7mer
186407-186426
0.004
2
7mer
71834-71847
0.004
2
7mer
43407-43433
0.004
4
6mer
126773-126794
0.004
9
7mer
172099-172112
0.004
2
7mer
182976-182993
0.004
Not Conserved
7mer
9477-9492
0.004
4
7mer
115195-115207
0.003
2
7mer
207062-207075
0.003
1
7mer
94307-94325
0.003
2
7mer
108854-108874
0.003
2
8mer
181677-181700
0.003
Not Conserved
7mer
178264-178282
0.003
2
7mer
54824-54843
0.003
2
8mer
145329-145356
0.003
1
8mer
119461-119476
0.003
7
6mer
9259-9266
0.003
6
7mer
158160-158186
0.003
1
7mer
131708-131728
0.003
1
6mer
65552-65578
0.003
1
7mer
252327-252343
0.003
1
6mer
125626-125630
0.002
7
7mer
220412-220429
0.002
2
7mer
136246-136261
0.002
1
6mer
73875-73894
0.002
7
6mer
26303-26321
0.002
5
6mer
48315-48338
0.002
3
6mer
94136-94150
0.002
4
6mer
154409-154431
0.002
4
6mer
100212-100232
0.002
5
7mer
203195-203217
0.002
2
6mer
75901-75927
0.002
5
6mer
196245-196269
0.002
4
7mer
203330-203352
0.002
1
6mer
166837-166850
0.002
9
6mer
210496-210518
0.002
4
6mer
13738-13755
0.002
3
7mer
115382-115405
0.002
1
6mer
200024-200048
0.002
2
6mer
62026-62036
0.002
2
6mer
52356-52364
0.002
2
7mer
108681-108704
0.002
1
6mer
169163-169183
0.002
1
6mer
226141-226161
0.002
4
6mer
183175-183195
0.002
6
6mer
133332-133344
0.002
3
6mer
86067-86082
0.002
2
6mer
208228-208244
0.002
Not Conserved
6mer
110854-110866
0.002
2
6mer
99161-99183
0.002
2
6mer
148537-148555
0.002
1
6mer
80166-80191
0.002
1
6mer
18434-18438
0.002
2
6mer
124555-124578
0.002
5
6mer
2480-2503
0.002
2
7mer
138305-138327
0.002
1
6mer
263814-263828
0.002
2
6mer
177092-177113
0.002
2
6mer
147014-147026
0.002
1
6mer
125893-125907
0.001
1
6mer
49039-49055
0.001
2
6mer
53402-53423
0.001
1
8mer
207497-207522
0.001
1
6mer
227050-227072
0.001
2
6mer
180338-180362
0.001
2
6mer
204871-204889
0.001
2
6mer
144574-144599
0.001
2
6mer
125692-125719
0.001
5
6mer
6180-6202
0.001
3
7mer
18059-18081
0.001
Not Conserved
6mer
139237-139264
0.001
1
6mer
16681-16699
0.001
4
6mer
155399-155413
0.001
1
7mer
140169-140195
0.001
3
6mer
116255-116271
0.001
2
6mer
227897-227911
0.001
2
6mer
34757-34773
0.001
3
6mer
210931-210952
0.001
3
6mer
148135-148153
0.001
3
7mer
98561-98573
0.001
1
6mer
80408-80424
0.001
1
6mer
209512-209536
0.001
1
6mer
139039-139059
0.001
4
6mer
111202-111216
0.001
1
6mer
122086-122104
0.001
1
6mer
239379-239401
0.001
2
6mer
43613-43631
0.001
3
6mer
5444-5460
0.001
1
6mer
75041-75057
0.001
3
6mer
224560-224580
0.001
2
6mer
217714-217731
0.001
2
6mer
233046-233071
0.001
2
6mer
195368-195390
0.001
1
6mer
202729-202742
0.001
Not Conserved
6mer
18849-18869
0.001
1
6mer
53181-53196
0.001
2
6mer
253968-253991
0.001
1
6mer
22751-22769
0.001
2
6mer
176914-176932
0.001
1
6mer
215262-215278
0.001
2
6mer
183257-183282
0.001
3
6mer
57137-57158
0.001
1
6mer
196915-196937
0.001
1
6mer
139982-139998
0.001
2
6mer
72109-72130
0.001
2
6mer
66702-66728
0.001
2
6mer
239696-239713
0.001
2
6mer
52457-52482
0.001
2
6mer
186174-186188
0.001
1
6mer
70824-70840
0.001
2
6mer
2212-2225
0.001
2
6mer
174186-174207
0.001
2
6mer
5125-5143
0.001
1
6mer
61132-61142
0.001
1
6mer
242927-242944
0.001
1
6mer
243806-243818
0.001
1
6mer
223941-223963
0.001
2
6mer
228859-228871
0.001
1
6mer
236147-236173
0.001
1
6mer
133336-133353
0.001
2
6mer
161425-161444
0.001
1
6mer
156330-156347
0.001
2
6mer
133903-133919
0.001
1
6mer
254397-254412
0.001
1
6mer
118291-118309
0.001
1
6mer
205957-205973
0.001
Not Conserved
6mer
204234-204253
0.001
1
6mer
70841-70860
0.001
Not Conserved
6mer
26345-26369
0.001
2
6mer
242927-242949
0.000
1
LINC01410
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000424345
Biotype: lincRNA
Gene id: ENSG00000238113
Gene Name: LINC01410
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
67-86
0.171
1
6mer
2758-2774
0.016
1
6mer
1930-1947
0.009
1
RP11-764K9.1
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000417843
Biotype: lincRNA
Gene id: ENSG00000225411
Gene Name: RP11-764K9.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2793-2812
0.169
1
6mer
104-126
0.016
1
6mer
933-950
0.008
1
XLOC_011494
hsa-miR-124-3p
1.000

Gene Details
Chromosome: chr15
Transcript: TCONS_00024132
Biotype: transcript isomorph
Gene id: XLOC_011494
Gene Name: XLOC_011494
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
73-92
0.161
2
6mer
243-262
0.014
2
LINC01410
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000427509
Biotype: lincRNA
Gene id: ENSG00000238113
Gene Name: LINC01410
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
71-90
0.170
1
CTC-360G5.9
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000599320
Biotype: lincRNA
Gene id: ENSG00000269486
Gene Name: CTC-360G5.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
118-137
0.167
2
6mer
375-399
0.002
Not Conserved
RP11-473M20.9
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000577123
Biotype: lincRNA
Gene id: ENSG00000262370
Gene Name: RP11-473M20.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
217-236
0.159
1
6mer
477-493
0.002
Not Conserved
XLOC_012370
hsa-miR-124-3p
1.000

Gene Details
Chromosome: chr17
Transcript: TCONS_00025543
Biotype: transcript isomorph
Gene id: XLOC_012370
Gene Name: XLOC_012370
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
203-222
0.146
1
6mer
466-490
0.011
1
LINC00960
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 3
Transcript: NR_040005.1
Biotype: lincRNA
Gene id: NR_040005.1 (gene)
Gene Name: LINC00960
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
527-553
0.145
2
CTC-459F4.3
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000588784
Biotype: lincRNA
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1987-2004
0.120
1
7mer
1259-1284
0.013
1
6mer
1100-1115
0.006
1
LINC01410
hsa-miR-124-3p
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000452184
Biotype: lincRNA
Gene id: ENSG00000238113
Gene Name: LINC01410
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
131-153
0.139
1
XLOC_010853
hsa-miR-124-3p
0.999

Gene Details
Chromosome: chr14
Transcript: TCONS_00022327
Biotype: transcript isomorph
Gene id: XLOC_010853
Gene Name: XLOC_010853
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Lymph Node Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
736-758
0.133
11
LINC00643
hsa-miR-124-3p
0.999

Gene Details
Chromosome: 14
Transcript: ENST00000623985
Biotype: lincRNA
Gene id: ENSG00000186369
Gene Name: LINC00643
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
736-758
0.132
11
CTD-2017D11.1
hsa-miR-124-3p
0.999

Gene Details
Chromosome: 19
Transcript: ENST00000594934
Biotype: lincRNA
Gene id: ENSG00000268362
Gene Name: CTD-2017D11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
729-745
0.109
2
6mer
1331-1351
0.015
2
LINC00643
hsa-miR-124-3p
0.998

Gene Details
Chromosome: 14
Transcript: ENST00000555934
Biotype: lincRNA
Gene id: ENSG00000186369
Gene Name: LINC00643
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
933-955
0.116
11
LINC00960
hsa-miR-124-3p
0.998

Gene Details
Chromosome: 3
Transcript: ENST00000463183
Biotype: lincRNA
Gene id: ENSG00000242516
Gene Name: LINC00960
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
417-443
0.113
2
CTD-2017D11.1
hsa-miR-124-3p
0.998

Gene Details
Chromosome: 19
Transcript: ENST00000597683
Biotype: lincRNA
Gene id: ENSG00000268362
Gene Name: CTD-2017D11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1052-1068
0.093
2
6mer
1654-1674
0.018
2
TMEM256-PLSCR3
hsa-miR-124-3p
0.998

Gene Details
Chromosome: 17
Transcript: NR_037719.1
Biotype: sense
Gene id: NR_037719.1 (gene)
Gene Name: TMEM256-PLSCR3
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
94-116
0.102
10
7mer
1328-1344
0.005
6
6mer
126-134
0.003
1
LOC284581
hsa-miR-124-3p
0.997

Gene Details
Chromosome: 1
Transcript: NR_046097.1
Biotype: lincRNA
Gene id: NR_046097.1 (gene)
Gene Name: LOC284581
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2358-2377
0.066
1
7mer
164-178
0.027
1
6mer
2096-2112
0.013
2
LINC00643
hsa-miR-124-3p
0.997

Gene Details
Chromosome: 14
Transcript: ENST00000334389
Biotype: lincRNA
Gene id: ENSG00000186369
Gene Name: LINC00643
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-124-3p
Sequence: uaaggcacgcggugaaugcc
MirBase ID: MIMAT0000422
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
571-593
0.090
11
6mer
3154-3178
0.007
1
6mer
986-991
0.003
Not Conserved
6mer
1637-1648
0.003
7
6mer
2083-2097
0.002
2
Funded by: