Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1248

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-1248
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
251172-251177
0.009
1
7mer
185575-185594
0.008
2
8mer
26766-26791
0.008
2
7mer
166628-166647
0.007
7
7mer
145808-145823
0.006
3
8mer
79027-79052
0.006
1
7mer
190735-190759
0.006
2
7mer
160130-160153
0.006
2
7mer
128215-128234
0.005
2
8mer
27656-27680
0.004
2
7mer
194009-194029
0.004
1
7mer
5036-5060
0.004
Not Conserved
7mer
80889-80908
0.004
2
7mer
15185-15209
0.004
2
7mer
170528-170548
0.004
2
9mer
184342-184366
0.004
1
7mer
51053-51078
0.004
1
7mer
70231-70248
0.004
1
7mer
11086-11110
0.004
1
7mer
67677-67702
0.004
2
7mer
198818-198840
0.004
2
7mer
111226-111249
0.004
2
8mer
258325-258349
0.004
2
7mer
10460-10486
0.003
2
7mer
34509-34527
0.003
2
7mer
6721-6739
0.003
4
7mer
129216-129233
0.003
4
7mer
57936-57954
0.003
2
7mer
171728-171747
0.003
2
7mer
62562-62580
0.003
2
8mer
228405-228416
0.003
2
7mer
109020-109045
0.003
2
7mer
49788-49811
0.003
2
7mer
7496-7515
0.003
3
7mer
70757-70783
0.003
1
6mer
60602-60624
0.003
3
7mer
182142-182164
0.003
5
8mer
234150-234171
0.003
2
7mer
103891-103909
0.003
1
6mer
180292-180316
0.003
3
6mer
100698-100716
0.002
8
7mer
39221-39240
0.002
3
7mer
225335-225353
0.002
1
6mer
99007-99020
0.002
4
7mer
139516-139543
0.002
3
7mer
224436-224458
0.002
4
7mer
262712-262727
0.002
2
6mer
87946-87966
0.002
2
7mer
207951-207972
0.002
1
7mer
262627-262651
0.002
1
6mer
26007-26029
0.002
5
6mer
109308-109332
0.002
2
6mer
658-684
0.002
2
6mer
1716-1742
0.002
6
7mer
28945-28968
0.002
1
6mer
69661-69679
0.002
2
6mer
52796-52809
0.002
5
6mer
85930-85944
0.002
3
6mer
74351-74369
0.002
2
6mer
22562-22583
0.002
1
6mer
86966-86992
0.002
Not Conserved
7mer
209605-209631
0.002
2
6mer
9691-9709
0.002
5
6mer
34856-34878
0.002
2
7mer
227620-227631
0.002
1
6mer
110835-110853
0.002
6
6mer
107487-107507
0.002
2
6mer
208611-208634
0.002
7
6mer
89274-89290
0.002
3
6mer
124420-124437
0.002
2
6mer
35422-35448
0.002
2
6mer
106690-106697
0.002
2
6mer
32800-32822
0.002
2
6mer
151607-151627
0.002
2
6mer
98193-98218
0.002
1
6mer
218100-218123
0.002
4
6mer
20135-20155
0.002
3
6mer
109922-109938
0.002
2
6mer
212821-212847
0.002
2
6mer
207774-207798
0.002
1
6mer
248939-248953
0.002
1
6mer
144319-144331
0.002
2
6mer
24161-24179
0.002
2
6mer
33594-33613
0.002
2
7mer
141989-142014
0.002
1
6mer
163053-163076
0.001
4
6mer
70543-70568
0.001
2
6mer
161962-161983
0.001
2
6mer
242011-242025
0.001
1
7mer
99303-99322
0.001
1
6mer
48338-48352
0.001
2
6mer
130405-130428
0.001
5
6mer
205279-205295
0.001
2
6mer
78557-78570
0.001
2
6mer
63147-63173
0.001
2
7mer
103980-104005
0.001
3
6mer
260222-260240
0.001
3
7mer
226412-226437
0.001
1
6mer
161618-161635
0.001
1
6mer
221078-221097
0.001
Not Conserved
7mer
87024-87040
0.001
2
6mer
99526-99550
0.001
1
6mer
69005-69031
0.001
2
6mer
22983-23009
0.001
2
6mer
180551-180575
0.001
1
6mer
147564-147584
0.001
1
6mer
72441-72464
0.001
3
6mer
233566-233584
0.001
1
7mer
145822-145835
0.001
2
6mer
200540-200566
0.001
1
6mer
90907-90931
0.001
2
6mer
234090-234116
0.001
2
6mer
88298-88319
0.001
2
7mer
194908-194929
0.001
2
7mer
140877-140892
0.001
2
6mer
127509-127527
0.001
2
6mer
240761-240779
0.001
2
7mer
161631-161650
0.001
2
6mer
8481-8503
0.001
1
6mer
35537-35562
0.001
2
6mer
128453-128476
0.001
3
6mer
240443-240469
0.001
2
6mer
186215-186239
0.001
1
6mer
220672-220687
0.001
3
6mer
166787-166803
0.001
2
6mer
257530-257549
0.001
Not Conserved
6mer
91078-91102
0.001
2
6mer
183431-183443
0.001
1
6mer
214906-214932
0.001
3
6mer
135124-135149
0.001
2
6mer
49993-50017
0.001
2
6mer
54053-54077
0.001
Not Conserved
6mer
215385-215409
0.001
2
6mer
262506-262527
0.001
2
6mer
97587-97605
0.001
1
6mer
103256-103274
0.001
2
6mer
264178-264203
0.001
1
6mer
227569-227591
0.001
2
6mer
206283-206307
0.001
Not Conserved
6mer
116733-116757
0.001
3
6mer
257936-257962
0.001
1
7mer
79145-79163
0.001
2
6mer
144064-144083
0.001
1
6mer
72573-72590
0.001
3
6mer
88388-88410
0.001
1
6mer
242760-242786
0.001
Not Conserved
7mer
139538-139558
0.001
Not Conserved
6mer
100436-100458
0.001
1
6mer
239825-239848
0.001
2
6mer
242155-242176
0.001
2
6mer
242815-242834
0.001
1
6mer
228460-228480
0.001
2
6mer
35441-35466
0.000
2
7mer
242777-242800
0.000
1
6mer
209629-209642
0.000
2
XLOC_013276
hsa-miR-1248
1.000

Gene Details
Chromosome: chr19
Transcript: TCONS_00027716
Biotype: transcript isomorph
Gene id: XLOC_013276
Gene Name: XLOC_013276
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
953-972
0.048
1
7mer
682-699
0.034
1
6mer
1061-1084
0.024
1
6mer
1046-1067
0.018
1
6mer
1345-1361
0.017
1
6mer
903-928
0.017
1
6mer
766-791
0.016
1
6mer
747-770
0.011
1
6mer
699-720
0.008
1
7mer
664-680
0.006
Not Conserved
7mer
292-307
0.006
Not Conserved
6mer
358-382
0.003
Not Conserved
6mer
488-507
0.003
Not Conserved
6mer
245-266
0.003
Not Conserved
GS1-519E5.1
hsa-miR-1248
1.000

Gene Details
Chromosome: X
Transcript: ENST00000432442
Biotype: lincRNA
Gene id: ENSG00000228543
Gene Name: GS1-519E5.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
73-97
0.014
3
7mer
437-459
0.010
1
7mer
222-244
0.010
1
7mer
198-223
0.009
Not Conserved
7mer
602-623
0.009
2
7mer
344-361
0.008
2
7mer
462-487
0.008
2
7mer
291-313
0.008
1
7mer
409-431
0.008
1
7mer
395-417
0.007
1
7mer
84-107
0.007
1
7mer
187-209
0.007
Not Conserved
7mer
176-195
0.007
Not Conserved
7mer
275-299
0.007
Not Conserved
7mer
374-396
0.006
Not Conserved
7mer
128-149
0.006
Not Conserved
7mer
156-177
0.006
Not Conserved
7mer
504-526
0.006
2
6mer
1541-1564
0.004
2
7mer
668-690
0.004
2
6mer
360-382
0.004
2
KCNQ1OT1
hsa-miR-1248
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
34055-34076
0.011
1
7mer
2344-2367
0.008
1
7mer
21560-21578
0.007
2
7mer
590-611
0.007
1
8mer
1121-1144
0.005
2
8mer
6859-6871
0.005
1
7mer
5137-5163
0.004
2
6mer
66387-66409
0.004
6
8mer
65429-65453
0.004
1
7mer
62622-62639
0.004
1
9mer
6782-6809
0.003
1
7mer
8169-8187
0.003
1
6mer
49946-49954
0.003
4
6mer
13573-13590
0.003
1
7mer
60426-60449
0.003
2
7mer
47204-47220
0.003
2
6mer
39976-39980
0.003
1
7mer
75916-75936
0.003
2
6mer
47809-47831
0.002
4
7mer
15101-15125
0.002
1
6mer
31095-31119
0.002
1
6mer
21764-21781
0.002
2
6mer
25143-25165
0.002
2
6mer
22873-22889
0.002
2
6mer
46730-46751
0.002
3
6mer
8296-8321
0.002
1
6mer
11021-11038
0.002
2
6mer
34363-34379
0.002
Not Conserved
7mer
74706-74733
0.002
1
6mer
23016-23040
0.002
2
6mer
38925-38938
0.002
1
6mer
4599-4618
0.002
2
6mer
16754-16777
0.002
2
6mer
87421-87439
0.002
4
6mer
42315-42337
0.002
2
7mer
35881-35895
0.002
1
6mer
44272-44292
0.002
4
6mer
54523-54548
0.002
2
7mer
73852-73875
0.002
1
6mer
32535-32549
0.002
1
6mer
60859-60879
0.001
1
6mer
28887-28908
0.001
1
6mer
73476-73489
0.001
1
6mer
79286-79312
0.001
2
6mer
19158-19177
0.001
2
6mer
55228-55251
0.001
2
6mer
3648-3673
0.001
Not Conserved
6mer
45221-45242
0.001
2
6mer
83605-83629
0.001
2
6mer
38280-38302
0.001
1
6mer
48095-48114
0.001
4
6mer
76166-76189
0.001
1
6mer
3479-3501
0.001
2
6mer
16028-16044
0.001
2
6mer
47547-47558
0.001
2
6mer
74035-74055
0.001
1
6mer
38816-38839
0.001
1
7mer
65074-65095
0.001
1
7mer
64945-64960
0.001
2
6mer
44921-44939
0.001
2
6mer
32201-32227
0.001
1
6mer
67536-67557
0.001
2
6mer
63517-63542
0.001
1
6mer
55219-55239
0.001
3
6mer
54495-54517
0.000
3
6mer
74629-74649
0.000
2
XLOC_002576
hsa-miR-1248
1.000

Gene Details
Chromosome: chr3
Transcript: TCONS_00005945
Biotype: transcript isomorph
Gene id: XLOC_002576
Gene Name: XLOC_002576
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
303-329
0.061
1
7mer
236-261
0.031
1
6mer
101-124
0.025
1
6mer
55-76
0.019
1
MIR6818
hsa-miR-1248
0.998

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
7566-7585
0.012
5
7mer
1080-1097
0.008
4
7mer
24306-24321
0.008
1
7mer
24879-24886
0.008
3
7mer
38529-38542
0.007
2
7mer
38278-38294
0.006
3
7mer
10249-10262
0.005
2
8mer
21225-21247
0.004
1
6mer
49180-49198
0.004
1
7mer
43005-43025
0.003
4
7mer
17425-17448
0.003
Not Conserved
7mer
25554-25572
0.003
1
6mer
44245-44263
0.003
4
6mer
28765-28789
0.003
2
7mer
1073-1094
0.002
3
6mer
43716-43741
0.002
10
7mer
21704-21729
0.002
2
7mer
35440-35458
0.002
1
7mer
9274-9294
0.002
2
6mer
30294-30300
0.002
2
6mer
21550-21569
0.002
4
6mer
4300-4322
0.002
4
7mer
16375-16402
0.002
5
6mer
20124-20148
0.002
2
6mer
15964-15989
0.002
1
6mer
42692-42716
0.002
1
6mer
29854-29870
0.002
1
6mer
16431-16457
0.002
2
6mer
1360-1383
0.002
3
6mer
41198-41212
0.001
2
6mer
11752-11778
0.001
2
6mer
4809-4828
0.001
2
6mer
8734-8760
0.001
1
6mer
35996-36011
0.001
1
6mer
45965-45981
0.001
2
6mer
35062-35077
0.001
2
6mer
27697-27721
0.001
2
6mer
8921-8942
0.001
2
6mer
38494-38518
0.001
2
XLOC_000199
hsa-miR-1248
0.998

Gene Details
Chromosome: chr1
Transcript: TCONS_00000200
Biotype: transcript isomorph
Gene id: XLOC_000199
Gene Name: XLOC_000199
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
199-221
0.096
2
6mer
580-604
0.012
2
6mer
1906-1928
0.006
1
RP3-323A16.1
hsa-miR-1248
0.997

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2956-2977
0.008
1
7mer
20793-20812
0.007
3
7mer
7730-7756
0.007
1
7mer
16760-16784
0.006
1
7mer
49807-49826
0.005
2
7mer
48775-48794
0.005
2
8mer
7092-7113
0.005
Not Conserved
7mer
27266-27293
0.004
2
7mer
40616-40642
0.003
3
7mer
32595-32616
0.003
Not Conserved
7mer
5869-5887
0.003
1
7mer
16382-16404
0.003
2
7mer
15046-15064
0.003
1
6mer
33456-33460
0.002
1
7mer
20280-20307
0.002
4
6mer
1766-1792
0.002
6
6mer
5637-5661
0.002
1
6mer
2768-2787
0.002
2
6mer
20065-20077
0.002
2
6mer
49155-49169
0.002
2
6mer
23643-23664
0.002
2
6mer
9706-9728
0.002
2
6mer
43273-43297
0.002
1
6mer
20225-20244
0.002
2
7mer
42138-42164
0.002
1
6mer
1497-1518
0.002
4
6mer
46291-46305
0.001
2
7mer
32608-32627
0.001
Not Conserved
7mer
32619-32638
0.001
Not Conserved
7mer
32759-32781
0.001
1
6mer
33993-34004
0.001
1
6mer
16327-16337
0.001
Not Conserved
6mer
51357-51381
0.001
3
6mer
14667-14691
0.001
2
7mer
32680-32705
0.001
Not Conserved
7mer
32716-32737
0.001
Not Conserved
6mer
51584-51600
0.001
2
6mer
47468-47483
0.001
Not Conserved
6mer
7818-7839
0.001
1
7mer
32630-32649
0.001
Not Conserved
6mer
49871-49884
0.001
2
6mer
9727-9749
0.001
2
6mer
40633-40650
0.001
1
7mer
16790-16815
0.000
2
MIR4313
hsa-miR-1248
0.996

Gene Details
Chromosome: 15
Transcript: ENST00000561777
Biotype: lincRNA
Gene id: ENSG00000261043
Gene Name: MIR4313
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2830-2849
0.062
2
8mer
2505-2529
0.021
1
6mer
2463-2479
0.010
2
8mer
2189-2211
0.007
1
7mer
459-481
0.003
Not Conserved
RP11-417E7.2
hsa-miR-1248
0.993

Gene Details
Chromosome: 6
Transcript: ENST00000564830
Biotype: lincRNA
Gene id: ENSG00000261039
Gene Name: RP11-417E7.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
331-354
0.091
2
XLOC_001401
hsa-miR-1248
0.992

Gene Details
Chromosome: chr2
Transcript: TCONS_00003609
Biotype: transcript isomorph
Gene id: XLOC_001401
Gene Name: XLOC_001401
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
141-166
0.058
1
6mer
498-517
0.012
1
6mer
937-961
0.011
1
6mer
475-499
0.009
1
AC006548.28
hsa-miR-1248
0.992

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
41927-41944
0.007
5
7mer
49797-49818
0.006
Not Conserved
9mer
43867-43892
0.005
2
7mer
58615-58620
0.004
2
7mer
10208-10231
0.004
2
7mer
11872-11892
0.003
1
6mer
1079-1102
0.003
2
7mer
51324-51349
0.003
Not Conserved
7mer
11278-11292
0.003
1
7mer
51546-51560
0.003
Not Conserved
7mer
5542-5567
0.002
2
6mer
28132-28159
0.002
1
6mer
21814-21834
0.002
3
7mer
10785-10805
0.002
2
6mer
13259-13285
0.002
3
6mer
28541-28559
0.002
1
6mer
54187-54211
0.002
Not Conserved
6mer
42603-42628
0.002
3
6mer
45276-45294
0.002
2
6mer
8290-8316
0.002
3
6mer
77634-77651
0.002
1
6mer
12188-12204
0.002
2
6mer
64489-64502
0.002
1
7mer
71933-71955
0.002
Not Conserved
6mer
6557-6582
0.002
6
6mer
38800-38824
0.002
2
6mer
36087-36107
0.002
3
9mer
12758-12774
0.001
1
7mer
11530-11555
0.001
1
6mer
61658-61683
0.001
2
6mer
23600-23622
0.001
1
6mer
49588-49609
0.001
Not Conserved
6mer
34726-34745
0.001
3
6mer
82809-82823
0.001
2
6mer
66382-66397
0.001
1
6mer
16016-16039
0.001
Not Conserved
6mer
60487-60505
0.001
2
6mer
63511-63531
0.001
2
6mer
10102-10119
0.001
2
6mer
44135-44156
0.001
1
6mer
43046-43071
0.001
1
6mer
13032-13056
0.001
2
6mer
41915-41931
0.001
2
XLOC_009925
hsa-miR-1248
0.991

Gene Details
Chromosome: chr12
Transcript: TCONS_00020607
Biotype: transcript isomorph
Gene id: XLOC_009925
Gene Name: XLOC_009925
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
309-322
0.065
2
7mer
198-222
0.024
1
TSIX
hsa-miR-1248
0.991

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2772-2791
0.010
2
8mer
7548-7567
0.009
1
7mer
10187-10211
0.009
1
8mer
29198-29211
0.006
1
7mer
33908-33925
0.005
3
7mer
6284-6304
0.004
2
8mer
21549-21574
0.004
2
7mer
22605-22623
0.004
3
7mer
13859-13881
0.003
Not Conserved
7mer
11355-11380
0.003
Not Conserved
6mer
21542-21562
0.003
4
7mer
12946-12969
0.002
Not Conserved
6mer
9810-9834
0.002
1
6mer
22769-22783
0.002
2
6mer
19500-19520
0.002
2
7mer
19687-19706
0.002
2
6mer
4407-4421
0.002
3
7mer
3134-3160
0.002
1
6mer
14690-14709
0.002
Not Conserved
6mer
17032-17057
0.002
1
6mer
11244-11261
0.001
Not Conserved
6mer
28672-28684
0.001
2
6mer
11817-11842
0.001
Not Conserved
6mer
4571-4593
0.001
2
6mer
2075-2102
0.001
Not Conserved
6mer
9906-9930
0.001
1
6mer
16308-16322
0.001
1
RP11-686D22.5
hsa-miR-1248
0.989

Gene Details
Chromosome: 17
Transcript: ENST00000589099
Biotype: lincRNA
Gene id: ENSG00000267711
Gene Name: RP11-686D22.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
358-369
0.067
1
7mer
287-311
0.008
Not Conserved
6mer
101-114
0.005
Not Conserved
7mer
216-240
0.005
Not Conserved
RP11-18F14.4
hsa-miR-1248
0.989

Gene Details
Chromosome: 16
Transcript: ENST00000563684
Biotype: sense_intronic
Gene id: ENSG00000260064
Gene Name: RP11-18F14.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
127-149
0.045
4
9mer
45-64
0.023
2
6mer
661-686
0.005
2
6mer
570-592
0.005
3
6mer
523-547
0.004
3
6mer
456-480
0.003
1
XLOC_001668
hsa-miR-1248
0.989

Gene Details
Chromosome: chr2
Transcript: TCONS_00003870
Biotype: transcript isomorph
Gene id: XLOC_001668
Gene Name: XLOC_001668
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4148-4166
0.027
2
6mer
5771-5796
0.014
2
6mer
5789-5809
0.012
2
7mer
3203-3229
0.011
1
6mer
639-653
0.011
2
6mer
1061-1086
0.010
2
RP6-74O6.6
hsa-miR-1248
0.988

Gene Details
Chromosome: 1
Transcript: ENST00000609678
Biotype: lincRNA
Gene id: ENSG00000272824
Gene Name: RP6-74O6.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
121-146
0.079
2
6mer
191-217
0.004
Not Conserved
LINC00662
hsa-miR-1248
0.987

Gene Details
Chromosome: 19
Transcript: ENST00000586954
Biotype: lincRNA
Gene id: ENSG00000261824
Gene Name: LINC00662
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1736-1760
0.027
1
6mer
1754-1767
0.019
1
6mer
2219-2234
0.019
1
6mer
466-488
0.010
1
7mer
117-122
0.007
Not Conserved
CTD-3105H18.13
hsa-miR-1248
0.985

Gene Details
Chromosome: 19
Transcript: ENST00000563695
Biotype: lincRNA
Gene id: ENSG00000261280
Gene Name: CTD-3105H18.13
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1248
Sequence: accuucuuguauaagcacugugcuaaa
MirBase ID: MIMAT0005900
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1365-1380
0.045
2
7mer
1884-1904
0.021
2
6mer
1839-1865
0.013
2
Funded by: