Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-125a-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-125a-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
33213-33232
0.015
4
8mer
139501-139514
0.011
10
9mer
2056-2075
0.010
6
8mer
93964-93987
0.009
Not Conserved
7mer
202550-202573
0.009
Not Conserved
7mer
205030-205056
0.009
2
9mer
11930-11949
0.008
2
7mer
168112-168125
0.008
2
7mer
140785-140801
0.007
4
8mer
131701-131714
0.007
5
7mer
4765-4783
0.006
1
8mer
221131-221155
0.006
1
8mer
227761-227778
0.006
2
7mer
86567-86590
0.006
2
7mer
49541-49562
0.005
4
9mer
217676-217702
0.005
4
7mer
81832-81854
0.005
9
8mer
108635-108653
0.005
2
7mer
29940-29956
0.005
4
7mer
254803-254822
0.005
3
8mer
54814-54838
0.004
2
7mer
170907-170929
0.004
2
8mer
98966-98991
0.004
2
7mer
27125-27137
0.003
3
7mer
125385-125412
0.003
9
7mer
185191-185213
0.003
2
8mer
44165-44185
0.003
3
7mer
74329-74344
0.003
2
8mer
136261-136279
0.003
2
7mer
163309-163333
0.003
2
7mer
104174-104192
0.003
2
7mer
40740-40762
0.003
1
8mer
80801-80823
0.003
2
8mer
142569-142585
0.003
4
7mer
234631-234655
0.003
2
7mer
52114-52140
0.003
2
6mer
70088-70113
0.003
6
7mer
107553-107567
0.003
6
7mer
60338-60361
0.003
1
6mer
53720-53735
0.003
5
7mer
237993-238012
0.003
1
7mer
85229-85253
0.003
2
7mer
184046-184067
0.003
2
7mer
262122-262143
0.003
2
7mer
11439-11458
0.003
1
7mer
123896-123911
0.003
2
7mer
225477-225501
0.003
1
7mer
69590-69615
0.003
2
6mer
214939-214956
0.003
5
8mer
41564-41584
0.003
2
7mer
238197-238218
0.003
2
7mer
15209-15234
0.002
2
7mer
98864-98889
0.002
2
7mer
199005-199028
0.002
1
7mer
51556-51580
0.002
2
7mer
169625-169651
0.002
2
7mer
146369-146393
0.002
1
6mer
119234-119252
0.002
11
7mer
67862-67883
0.002
2
7mer
121562-121582
0.002
2
7mer
193446-193467
0.002
1
7mer
175034-175056
0.002
1
7mer
252047-252066
0.002
1
7mer
75594-75619
0.002
2
6mer
59031-59048
0.002
2
7mer
13993-14020
0.002
1
7mer
37576-37602
0.002
1
7mer
107711-107734
0.002
3
7mer
212712-212733
0.002
1
6mer
119946-119962
0.002
9
6mer
1112-1138
0.002
1
7mer
253372-253396
0.002
Not Conserved
6mer
166826-166846
0.002
9
7mer
188866-188890
0.002
1
6mer
99183-99203
0.002
3
6mer
203724-203743
0.002
2
7mer
25481-25502
0.002
2
7mer
102909-102933
0.002
2
7mer
85577-85601
0.002
1
8mer
88802-88824
0.002
2
7mer
261899-261918
0.002
2
7mer
1846-1867
0.002
2
6mer
55013-55027
0.002
3
7mer
236457-236481
0.002
1
6mer
249296-249311
0.002
1
7mer
179952-179973
0.002
3
8mer
61651-61664
0.002
2
8mer
258655-258676
0.002
2
6mer
142309-142334
0.002
2
6mer
186302-186324
0.002
1
7mer
223540-223564
0.002
2
7mer
14141-14165
0.002
2
6mer
172811-172833
0.002
1
8mer
242292-242318
0.002
1
7mer
174466-174490
0.002
Not Conserved
7mer
103009-103028
0.002
2
7mer
238290-238312
0.002
1
6mer
115762-115785
0.002
4
7mer
14583-14603
0.002
1
7mer
117702-117727
0.002
1
6mer
223037-223058
0.002
2
6mer
38716-38731
0.001
1
6mer
11005-11030
0.001
2
6mer
2892-2912
0.001
2
6mer
236039-236063
0.001
2
7mer
206225-206251
0.001
Not Conserved
6mer
243610-243621
0.001
1
6mer
180672-180693
0.001
2
6mer
192261-192285
0.001
2
7mer
86598-86621
0.001
2
6mer
260292-260314
0.001
2
6mer
26375-26390
0.001
4
6mer
33385-33409
0.001
7
6mer
207673-207688
0.001
2
6mer
93581-93592
0.001
4
6mer
232871-232890
0.001
2
6mer
109617-109635
0.001
2
6mer
109140-109155
0.001
1
6mer
75393-75412
0.001
2
6mer
234035-234058
0.001
2
7mer
67954-67976
0.001
2
6mer
174091-174117
0.001
1
6mer
48126-48139
0.001
4
6mer
16718-16743
0.001
2
6mer
219464-219487
0.001
1
6mer
204442-204463
0.001
1
6mer
185325-185337
0.001
3
6mer
113465-113478
0.001
2
7mer
38272-38293
0.001
2
7mer
146410-146434
0.001
2
6mer
161419-161435
0.001
3
6mer
42921-42939
0.001
2
7mer
161135-161152
0.001
2
6mer
62163-62188
0.001
1
6mer
154058-154079
0.001
2
7mer
262220-262239
0.001
Not Conserved
7mer
258726-258744
0.001
2
6mer
183483-183502
0.001
1
6mer
38228-38252
0.001
1
6mer
118244-118264
0.001
10
6mer
233608-233632
0.001
2
6mer
119526-119543
0.001
6
6mer
125175-125192
0.001
1
6mer
108408-108426
0.001
2
6mer
48944-48960
0.001
2
6mer
77168-77179
0.001
1
6mer
209886-209904
0.001
2
6mer
228843-228866
0.001
1
6mer
139978-139993
0.001
2
6mer
243798-243813
0.001
1
6mer
205952-205968
0.001
1
6mer
252989-253014
0.001
2
6mer
246815-246840
0.001
1
7mer
225521-225542
0.001
1
6mer
133898-133914
0.001
1
6mer
227366-227384
0.001
2
6mer
236132-236158
0.001
3
6mer
21542-21560
0.001
6
6mer
140329-140355
0.001
1
6mer
138024-138042
0.001
1
6mer
226852-226867
0.001
2
6mer
214032-214055
0.001
3
6mer
255499-255522
0.001
1
6mer
34338-34353
0.001
1
6mer
188641-188657
0.001
2
7mer
184140-184163
0.001
1
6mer
215905-215923
0.001
1
6mer
215269-215290
0.001
1
6mer
136584-136607
0.001
1
6mer
34914-34935
0.001
2
6mer
138707-138725
0.001
Not Conserved
6mer
138338-138359
0.001
1
6mer
6329-6345
0.001
2
6mer
52200-52226
0.001
2
6mer
252796-252814
0.001
1
6mer
244643-244661
0.001
1
6mer
23643-23668
0.001
2
6mer
101516-101536
0.001
1
8mer+mismatch
211957-211980
0.001
1
6mer
194435-194453
0.001
1
6mer
122911-122933
0.001
1
6mer
94924-94942
0.001
Not Conserved
6mer
193488-193514
0.001
1
6mer
118123-118145
0.001
1
6mer
159647-159663
0.001
Not Conserved
6mer
246842-246861
0.001
1
6mer
76289-76307
0.001
1
6mer
128582-128599
0.001
2
6mer
194523-194539
0.000
2
6mer
136699-136716
0.000
2
6mer
158407-158425
0.000
Not Conserved
7mer
1913-1933
0.000
2
6mer
113564-113577
0.000
1
6mer
41649-41667
0.000
2
6mer
123195-123214
0.000
1
6mer
226945-226961
0.000
4
6mer
123290-123309
0.000
1
6mer
255553-255571
0.000
1
KCNQ1OT1
hsa-miR-125a-3p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
52133-52157
0.012
2
8mer
40779-40806
0.011
2
9mer
35218-35245
0.008
1
8mer
67978-67997
0.008
3
7mer
89683-89698
0.007
7
7mer
437-461
0.006
1
9mer
12164-12188
0.006
1
7mer
45625-45640
0.005
9
8mer
47409-47425
0.005
2
6mer
54184-54201
0.005
8
8mer
12791-12813
0.005
2
7mer
18476-18500
0.004
1
7mer
55400-55420
0.004
5
7mer
57995-58021
0.004
4
7mer
64285-64305
0.004
2
7mer
275-294
0.003
1
7mer
45786-45802
0.003
7
7mer
55164-55186
0.003
3
6mer
17558-17578
0.003
1
7mer
90184-90202
0.003
2
7mer
3160-3184
0.002
Not Conserved
7mer
85699-85725
0.002
4
6mer
34416-34440
0.002
1
6mer
60880-60905
0.002
4
6mer
65236-65259
0.002
5
7mer
80823-80845
0.002
1
6mer
10556-10575
0.002
2
6mer
19700-19719
0.002
2
6mer
11565-11592
0.002
2
6mer
20147-20162
0.002
2
6mer
49136-49159
0.002
1
8mer
31829-31849
0.002
1
6mer
48035-48049
0.002
2
6mer
49469-49487
0.002
3
7mer
77199-77213
0.002
2
6mer
47711-47735
0.002
4
6mer
51248-51262
0.002
2
6mer
21486-21503
0.002
1
7mer
61784-61804
0.002
2
6mer
29135-29150
0.002
1
6mer
38339-38361
0.002
1
7mer
64609-64631
0.002
2
6mer
87315-87341
0.001
2
6mer
76809-76834
0.001
2
6mer
59547-59572
0.001
3
6mer
74201-74220
0.001
2
6mer
84181-84205
0.001
2
6mer
82522-82545
0.001
1
6mer
80515-80531
0.001
2
6mer
69118-69137
0.001
2
6mer
54714-54730
0.001
2
6mer
83347-83367
0.001
2
6mer
81310-81329
0.001
2
6mer
81501-81522
0.001
4
6mer
63976-63996
0.001
3
7mer
12123-12147
0.001
1
6mer
23289-23311
0.001
Not Conserved
6mer
47623-47647
0.001
6
6mer
36718-36738
0.001
Not Conserved
6mer
38770-38782
0.001
1
6mer
66706-66725
0.001
4
8mer+mismatch
46157-46182
0.001
2
6mer
36975-36999
0.001
1
6mer
46531-46555
0.001
1
6mer
61612-61628
0.001
1
6mer
77436-77456
0.001
1
6mer
37274-37299
0.001
1
6mer
57559-57577
0.001
2
7mer
36893-36917
0.001
1
6mer
31765-31781
0.001
1
6mer
54652-54675
0.000
2
6mer
77326-77350
0.000
1
6mer
37066-37086
0.000
1
AC006548.28
hsa-miR-125a-3p
0.999

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
37214-37237
0.017
2
8mer
84160-84173
0.014
1
7mer
44909-44922
0.006
2
7mer
39148-39166
0.004
1
7mer
79540-79562
0.004
Not Conserved
7mer
83374-83399
0.003
1
7mer
81602-81623
0.003
2
7mer
40853-40875
0.003
1
9mer
63206-63230
0.003
2
7mer
33056-33080
0.002
1
7mer
36057-36076
0.002
2
7mer
15118-15137
0.002
6
6mer
71049-71072
0.002
Not Conserved
7mer
11067-11091
0.002
2
7mer
41553-41575
0.002
1
6mer
4713-4731
0.002
2
8mer
72367-72392
0.002
Not Conserved
6mer
3083-3103
0.002
3
7mer
62174-62195
0.001
2
6mer
22152-22174
0.001
1
6mer
13909-13926
0.001
2
8mer+wobble
39906-39925
0.001
2
6mer
9920-9935
0.001
2
6mer
44417-44439
0.001
Not Conserved
6mer
24221-24241
0.001
1
6mer
61946-61971
0.001
2
7mer
6549-6565
0.001
2
6mer
42147-42174
0.001
Not Conserved
6mer
58959-58979
0.001
1
8mer
59290-59304
0.001
2
6mer
36925-36948
0.001
1
6mer
7547-7563
0.001
2
6mer
21735-21755
0.001
5
6mer
13099-13123
0.001
2
6mer
16567-16588
0.001
2
6mer
41131-41143
0.001
2
6mer
17714-17732
0.001
2
6mer
8312-8330
0.001
1
6mer
43159-43180
0.001
2
6mer
5918-5944
0.001
2
6mer
19800-19822
0.001
2
6mer
58517-58537
0.001
1
6mer
25693-25708
0.001
2
6mer
82461-82477
0.001
1
6mer
1670-1692
0.001
2
6mer
22471-22483
0.001
2
6mer
44382-44404
0.001
4
6mer
36210-36233
0.001
1
6mer
15256-15274
0.001
1
6mer
60193-60215
0.001
2
6mer
17127-17144
0.001
1
7mer
12497-12514
0.001
1
6mer
74793-74808
0.001
1
6mer
8731-8746
0.001
1
6mer
8522-8539
0.001
1
6mer
65227-65244
0.001
1
6mer
58199-58222
0.001
Not Conserved
6mer
7973-7993
0.001
2
6mer
51878-51900
0.001
Not Conserved
6mer
71963-71981
0.000
Not Conserved
6mer
37945-37970
0.000
1
6mer
41484-41503
0.000
1
6mer
45495-45510
0.000
Not Conserved
6mer
82428-82447
0.000
1
6mer
71903-71924
0.000
1
6mer
39888-39914
0.000
2
6mer
57985-58006
0.000
1
RP3-323A16.1
hsa-miR-125a-3p
0.999

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
53659-53675
0.018
2
9mer
45600-45617
0.010
2
8mer
11378-11394
0.006
2
7mer
24489-24502
0.004
2
7mer
13872-13898
0.004
3
7mer
554-571
0.004
Not Conserved
7mer
18200-18224
0.003
1
7mer
25384-25410
0.003
2
7mer
52053-52071
0.003
2
7mer
9135-9161
0.003
2
7mer
28233-28244
0.003
1
7mer
38868-38892
0.003
2
7mer
50811-50836
0.003
1
7mer
36580-36604
0.003
1
6mer
22516-22529
0.003
4
6mer
15967-15983
0.002
3
7mer
31584-31604
0.002
2
6mer
37275-37294
0.002
7
7mer
27883-27907
0.002
1
7mer
3120-3139
0.002
2
7mer
10950-10976
0.002
1
6mer
12729-12748
0.002
1
6mer
10220-10243
0.002
1
6mer
6227-6242
0.002
1
7mer
14806-14833
0.002
3
6mer
49110-49127
0.002
1
6mer
47403-47421
0.002
2
6mer
52282-52307
0.002
1
7mer
28261-28285
0.002
2
6mer
485-503
0.001
1
6mer
39376-39401
0.001
2
6mer
16937-16948
0.001
3
6mer
51334-51352
0.001
3
7mer
28367-28386
0.001
2
6mer
32487-32506
0.001
Not Conserved
6mer
43894-43913
0.001
2
7mer
18336-18358
0.001
1
6mer
51638-51660
0.001
1
6mer
4970-4988
0.001
Not Conserved
6mer
19562-19588
0.001
Not Conserved
6mer
47600-47617
0.001
Not Conserved
6mer
11491-11516
0.001
2
6mer
34177-34203
0.001
1
6mer
42428-42444
0.001
2
6mer
21594-21614
0.001
Not Conserved
7mer
16959-16979
0.001
3
6mer
28491-28514
0.001
Not Conserved
6mer
37760-37775
0.001
2
7mer
12823-12835
0.001
2
6mer
11593-11609
0.000
2
6mer
50926-50945
0.000
1
6mer
16989-17006
0.000
2
XLOC_013024
hsa-miR-125a-3p
0.999

Gene Details
Chromosome: chr19
Transcript: TCONS_00026972
Biotype: transcript isomorph
Gene id: XLOC_013024
Gene Name: XLOC_013024
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
778-798
0.020
1
7mer
63-81
0.019
1
6mer
577-600
0.015
1
6mer
879-902
0.012
1
6mer
739-762
0.012
1
6mer
127-148
0.011
1
6mer
647-669
0.010
1
6mer
402-425
0.008
1
6mer
612-634
0.007
1
6mer
193-218
0.002
Not Conserved
RP11-180P8.3
hsa-miR-125a-3p
0.998

Gene Details
Chromosome: 17
Transcript: ENST00000581596
Biotype: lincRNA
Gene id: ENSG00000266411
Gene Name: RP11-180P8.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
850-872
0.104
8
6mer
632-650
0.007
7
8mer+wobble
309-333
0.005
5
XLOC_001612
hsa-miR-125a-3p
0.997

Gene Details
Chromosome: chr2
Transcript: TCONS_00002651
Biotype: transcript isomorph
Gene id: XLOC_001612
Gene Name: XLOC_001612
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
264-289
0.057
1
7mer
83-99
0.050
1
TTTY10
hsa-miR-125a-3p
0.997

Gene Details
Chromosome: Y
Transcript: ENST00000455084
Biotype: lincRNA
Gene id: ENSG00000229236
Gene Name: TTTY10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1186-1201
0.056
1
7mer
1495-1516
0.051
1
MIR4534
hsa-miR-125a-3p
0.997

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
29496-29517
0.007
10
7mer
25457-25481
0.007
11
8mer
847-868
0.005
2
7mer
32815-32830
0.004
2
7mer
47543-47566
0.003
2
8mer
16879-16903
0.003
Not Conserved
7mer
21666-21685
0.003
2
7mer
19465-19488
0.003
1
7mer
39704-39715
0.003
1
7mer
16452-16468
0.003
Not Conserved
6mer
35175-35201
0.003
12
7mer
18709-18732
0.002
3
7mer
3204-3227
0.002
1
6mer
35495-35519
0.002
8
7mer
47341-47364
0.002
2
7mer
28672-28694
0.002
1
7mer
15510-15534
0.002
2
6mer
36456-36475
0.002
7
6mer
54149-54170
0.002
2
6mer
54497-54523
0.002
1
6mer
35678-35704
0.002
6
6mer
53604-53625
0.002
2
7mer
6947-6971
0.002
1
6mer
20997-21022
0.002
4
7mer
22114-22133
0.002
Not Conserved
9mer
13374-13392
0.002
Not Conserved
6mer
10394-10411
0.001
2
7mer
40059-40083
0.001
Not Conserved
8mer+mismatch
2045-2067
0.001
1
6mer
15799-15824
0.001
2
7mer
40158-40177
0.001
2
6mer
11194-11210
0.001
3
6mer
41372-41389
0.001
2
6mer
48527-48550
0.001
2
6mer
38977-38996
0.001
1
6mer
43362-43385
0.001
2
6mer
19941-19963
0.001
7
6mer
17466-17492
0.001
2
6mer
53776-53794
0.001
1
6mer
11682-11699
0.001
2
6mer
51599-51616
0.001
4
6mer
12723-12744
0.001
2
6mer
23411-23436
0.001
3
6mer
46563-46584
0.001
1
6mer
10936-10961
0.001
2
6mer
26225-26248
0.001
2
6mer
17000-17017
0.001
7
6mer
23240-23264
0.001
1
6mer
1252-1268
0.001
2
6mer
28191-28209
0.001
2
9mer
39141-39161
0.001
2
6mer
38554-38575
0.001
3
6mer
34852-34873
0.001
3
6mer
25010-25022
0.001
1
6mer
49262-49285
0.001
3
6mer
49989-50007
0.001
1
6mer
2236-2250
0.001
1
6mer
12015-12033
0.001
1
6mer
1385-1403
0.001
2
6mer
51199-51218
0.000
Not Conserved
6mer
51831-51852
0.000
2
6mer
14462-14488
0.000
Not Conserved
6mer
16933-16951
0.000
1
PCAT19
hsa-miR-125a-3p
0.997

Gene Details
Chromosome: 19
Transcript: ENST00000595837
Biotype: lincRNA
Gene id: ENSG00000267107
Gene Name: PCAT19
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
7-25
0.093
2
9mer
1004-1023
0.013
1
CTA-221G9.11
hsa-miR-125a-3p
0.997

Gene Details
Chromosome: 22
Transcript: ENST00000623422
Biotype: lincRNA
Gene id: ENSG00000279298
Gene Name: CTA-221G9.11
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
822-846
0.047
1
7mer
34-56
0.030
1
7mer
863-887
0.028
1
XLOC_006111
hsa-miR-125a-3p
0.997

Gene Details
Chromosome: chr7
Transcript: TCONS_00013454
Biotype: transcript isomorph
Gene id: XLOC_006111
Gene Name: XLOC_006111
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
21-46
0.083
2
7mer
754-776
0.021
2
RP11-776A13.3
hsa-miR-125a-3p
0.996

Gene Details
Chromosome: 12
Transcript: ENST00000551287
Biotype: lincRNA
Gene id: ENSG00000257756
Gene Name: RP11-776A13.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
29-54
0.100
2
AC011525.2
hsa-miR-125a-3p
0.995

Gene Details
Chromosome: 19
Transcript: ENST00000562167
Biotype: lincRNA
Gene id: ENSG00000261400
Gene Name: AC011525.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5369-5382
0.038
9
7mer
275-297
0.017
1
8mer
5607-5629
0.017
3
6mer
4463-4489
0.007
10
8mer
2076-2092
0.006
2
6mer
5590-5610
0.005
2
6mer
668-685
0.003
3
7mer
3676-3702
0.003
2
7mer
1261-1278
0.002
1
XLOC_009474
hsa-miR-125a-3p
0.995

Gene Details
Chromosome: chr11
Transcript: TCONS_00019666
Biotype: transcript isomorph
Gene id: XLOC_009474
Gene Name: XLOC_009474
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
6891-6917
0.045
8
8mer
5958-5969
0.021
9
7mer
3346-3351
0.017
9
7mer
4961-4983
0.006
8
6mer
7173-7190
0.004
3
6mer
2418-2439
0.002
4
6mer
1455-1470
0.001
3
6mer
4176-4201
0.001
2
PCAT19
hsa-miR-125a-3p
0.993

Gene Details
Chromosome: 19
Transcript: ENST00000588495
Biotype: lincRNA
Gene id: ENSG00000267107
Gene Name: PCAT19
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1155-1173
0.038
2
8mer
281-301
0.021
1
7mer
791-818
0.018
2
7mer
1062-1084
0.009
2
9mer
2152-2171
0.006
1
6mer
2552-2578
0.001
Not Conserved
RP11-255A11.2
hsa-miR-125a-3p
0.992

Gene Details
Chromosome: 9
Transcript: ENST00000420315
Biotype: antisense
Gene id: ENSG00000228072
Gene Name: RP11-255A11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
33-51
0.065
1
7mer
273-300
0.024
1
XLOC_011835
hsa-miR-125a-3p
0.992

Gene Details
Chromosome: chr16
Transcript: TCONS_00024916
Biotype: transcript isomorph
Gene id: XLOC_011835
Gene Name: XLOC_011835
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
442-465
0.023
3
8mer
407-431
0.014
2
8mer
525-548
0.014
2
8mer
379-403
0.012
2
8mer
423-448
0.010
Not Conserved
8mer
607-631
0.007
2
7mer
557-581
0.005
2
6mer
457-482
0.003
2
8mer+wobble
489-514
0.002
1
TTTY15
hsa-miR-125a-3p
0.992

Gene Details
Chromosome: Y
Transcript: NR_001545.2
Biotype: lincRNA
Gene id: NR_001545.2 (gene)
Gene Name: TTTY15
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
272-292
0.038
1
7mer
4023-4047
0.023
1
8mer
1321-1347
0.014
1
6mer
1281-1303
0.007
1
6mer
4119-4137
0.006
1
6mer
1546-1564
0.001
Not Conserved
XLOC_013274
hsa-miR-125a-3p
0.991

Gene Details
Chromosome: chr19
Transcript: TCONS_00027238
Biotype: transcript isomorph
Gene id: XLOC_013274
Gene Name: XLOC_013274
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-125a-3p
Sequence: acaggugagguucuugggagcc
MirBase ID: MIMAT0004602
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4886-4910
0.016
1
8mer+mismatch
5533-5557
0.013
2
6mer
244-267
0.012
2
6mer
330-355
0.012
2
7mer
696-715
0.009
1
7mer
864-886
0.006
1
6mer
6390-6411
0.005
1
6mer
6061-6085
0.005
1
6mer
1323-1347
0.005
2
6mer
3163-3179
0.005
2
Funded by: