Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-126-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC009403.2
hsa-miR-126-3p
0.956

Gene Details
Chromosome: 7
Transcript: ENST00000474963
Biotype: antisense
Gene id: ENSG00000216895
Gene Name: AC009403.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
381-406
0.061
1
AC009403.2
hsa-miR-126-3p
0.902

Gene Details
Chromosome: 7
Transcript: ENST00000469539
Biotype: antisense
Gene id: ENSG00000216895
Gene Name: AC009403.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
264-289
0.047
1
XLOC_012528
hsa-miR-126-3p
0.896

Gene Details
Chromosome: chr17
Transcript: TCONS_00025700
Biotype: transcript isomorph
Gene id: XLOC_012528
Gene Name: XLOC_012528
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
395-416
0.046
2
XLOC_012427
hsa-miR-126-3p
0.888

Gene Details
Chromosome: chr17
Transcript: TCONS_00025599
Biotype: transcript isomorph
Gene id: XLOC_012427
Gene Name: XLOC_012427
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
431-439
0.045
1
XLOC_006786
hsa-miR-126-3p
0.880

Gene Details
Chromosome: chr8
Transcript: TCONS_00014687
Biotype: transcript isomorph
Gene id: XLOC_006786
Gene Name: XLOC_006786
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
710-724
0.043
1
XLOC_006946
hsa-miR-126-3p
0.837

Gene Details
Chromosome: chr8
Transcript: TCONS_00014878
Biotype: transcript isomorph
Gene id: XLOC_006946
Gene Name: XLOC_006946
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1320-1341
0.037
1
XLOC_012360
hsa-miR-126-3p
0.828

Gene Details
Chromosome: chr17
Transcript: TCONS_00026020
Biotype: transcript isomorph
Gene id: XLOC_012360
Gene Name: XLOC_012360
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
141-160
0.005
1
6mer
195-222
0.004
1
6mer
339-358
0.004
1
6mer
368-384
0.004
1
6mer
253-272
0.003
1
6mer
224-251
0.003
1
6mer
624-640
0.003
Not Conserved
6mer
594-610
0.003
Not Conserved
6mer
398-415
0.002
Not Conserved
6mer
425-441
0.002
Not Conserved
6mer
455-474
0.002
Not Conserved
6mer
312-329
0.002
Not Conserved
6mer
484-501
0.001
Not Conserved
RP11-332H17.1
hsa-miR-126-3p
0.811

Gene Details
Chromosome: 1
Transcript: ENST00000440321
Biotype: antisense
Gene id: ENSG00000232959
Gene Name: RP11-332H17.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
199-216
0.034
2
RP11-44M6.7
hsa-miR-126-3p
0.808

Gene Details
Chromosome: 7
Transcript: ENST00000485071
Biotype: retained_intron
Gene id: ENSG00000274272
Gene Name: RP11-44M6.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4203-4223
0.034
5
CTC-459F4.3
hsa-miR-126-3p
0.806

Gene Details
Chromosome: 19
Transcript: ENST00000588784
Biotype: lincRNA
Gene id: ENSG00000267575
Gene Name: CTC-459F4.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
81-104
0.018
1
6mer
129-144
0.016
1
LINC00665
hsa-miR-126-3p
0.776

Gene Details
Chromosome: 19
Transcript: ENST00000591372
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2525-2550
0.030
1
6mer
2026-2047
0.001
Not Conserved
AC091801.1
hsa-miR-126-3p
0.774

Gene Details
Chromosome: 7
Transcript: ENST00000403226
Biotype: lincRNA
Gene id: ENSG00000217455
Gene Name: AC091801.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
721-738
0.031
1
RP4-718D20.3
hsa-miR-126-3p
0.762

Gene Details
Chromosome: 20
Transcript: ENST00000608187
Biotype: retained_intron
Gene id: ENSG00000232675
Gene Name: RP4-718D20.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
605-627
0.030
1
LINC00665
hsa-miR-126-3p
0.752

Gene Details
Chromosome: 19
Transcript: ENST00000590622
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1473-1498
0.029
1
LINC00665
hsa-miR-126-3p
0.749

Gene Details
Chromosome: 19
Transcript: ENST00000438368
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1597-1622
0.029
1
LINC00665
hsa-miR-126-3p
0.749

Gene Details
Chromosome: 19
Transcript: ENST00000585356
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1292-1317
0.029
1
XXbac-B476C20.9
hsa-miR-126-3p
0.721

Gene Details
Chromosome: 22
Transcript: ENST00000426483
Biotype: antisense
Gene id: ENSG00000225335
Gene Name: XXbac-B476C20.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-126-3p
Sequence: ucguaccgugaguaauaaugcg
MirBase ID: MIMAT0000445
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer+wobble
135-152
0.026
1
Funded by: