Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-1287-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
105777-105797
0.033
2
7mer
164143-164156
0.012
11
7mer
114553-114580
0.005
7
7mer
48375-48401
0.005
4
7mer
52130-52150
0.004
2
9mer
148626-148645
0.004
2
7mer
216358-216371
0.004
4
7mer
225490-225511
0.004
Not Conserved
7mer
211196-211223
0.003
1
7mer
79037-79063
0.003
2
6mer
81693-81716
0.003
10
7mer
218634-218659
0.003
1
7mer
173689-173710
0.003
2
7mer
46002-46027
0.003
2
8mer
232751-232771
0.003
2
9mer
113197-113216
0.003
5
7mer
103104-103123
0.003
2
6mer
124824-124844
0.003
7
7mer
255027-255043
0.003
2
7mer
115238-115263
0.003
1
8mer
122796-122816
0.003
2
7mer
110125-110142
0.003
2
7mer
107481-107494
0.002
2
7mer
209636-209654
0.002
2
7mer
133256-133282
0.002
2
6mer
100120-100139
0.002
7
6mer
219940-219966
0.002
8
6mer
206784-206798
0.002
2
6mer
254499-254516
0.002
9
6mer
119376-119392
0.002
9
7mer
120703-120726
0.002
1
8mer
113557-113573
0.002
1
6mer
257172-257186
0.002
2
6mer
27376-27402
0.002
Not Conserved
7mer
225946-225972
0.002
Not Conserved
6mer
216082-216095
0.002
6
6mer
208408-208423
0.002
5
6mer
59947-59967
0.002
2
6mer
37677-37697
0.002
2
6mer
163950-163964
0.002
4
6mer
109366-109379
0.002
2
7mer
225853-225874
0.002
2
7mer
115750-115769
0.002
1
6mer
254839-254859
0.002
2
6mer
98474-98493
0.002
5
7mer
148741-148759
0.002
3
6mer
30595-30612
0.002
1
6mer
111160-111173
0.001
1
6mer
159165-159191
0.001
4
6mer
113008-113029
0.001
3
6mer
184239-184257
0.001
2
6mer
3887-3913
0.001
2
6mer
106791-106806
0.001
3
6mer
182028-182049
0.001
3
6mer
231483-231502
0.001
1
6mer
209133-209154
0.001
2
6mer
119550-119564
0.001
5
6mer
266642-266660
0.001
1
6mer
6094-6112
0.001
2
7mer
81084-81104
0.001
5
6mer
195815-195838
0.001
2
6mer
224961-224979
0.001
2
7mer
256856-256882
0.001
1
6mer
86492-86512
0.001
2
6mer
53358-53382
0.001
2
6mer
33693-33718
0.001
2
6mer
177953-177973
0.001
2
6mer
124032-124055
0.001
4
6mer
96511-96538
0.001
4
6mer
150767-150787
0.001
1
6mer
151568-151587
0.001
4
6mer
233081-233108
0.001
1
6mer
107797-107809
0.001
2
6mer
188130-188156
0.001
3
6mer
186349-186363
0.001
4
6mer
162728-162746
0.001
2
6mer
44271-44297
0.001
2
6mer
202306-202327
0.001
Not Conserved
6mer
49517-49542
0.001
2
6mer
70497-70521
0.001
1
6mer
255287-255302
0.001
1
6mer
46936-46960
0.001
4
6mer
6419-6445
0.001
1
6mer
85769-85787
0.001
2
6mer
155724-155742
0.001
2
6mer
34484-34501
0.001
2
6mer
242726-242748
0.001
1
6mer
41114-41137
0.001
2
6mer
156699-156710
0.001
2
6mer
222385-222410
0.001
2
6mer
257685-257711
0.001
2
6mer
235155-235173
0.001
2
6mer
21269-21284
0.001
5
6mer
96965-96982
0.001
4
7mer
227415-227435
0.001
2
6mer
95762-95786
0.001
4
6mer
238388-238406
0.001
2
6mer
111400-111425
0.001
4
6mer
122446-122464
0.001
1
6mer
237105-237130
0.001
2
6mer
240661-240680
0.001
2
6mer
7724-7747
0.001
1
6mer
221763-221781
0.001
2
6mer
14508-14526
0.001
1
6mer
38462-38480
0.001
1
6mer
75787-75805
0.001
1
6mer
126178-126203
0.001
1
6mer
251767-251792
0.001
1
6mer
146599-146623
0.001
2
6mer
250265-250281
0.001
1
6mer
261988-262006
0.001
2
6mer
237691-237718
0.001
4
6mer
121357-121375
0.001
2
6mer
143720-143737
0.001
1
6mer
209995-210018
0.001
1
6mer
23124-23148
0.001
3
6mer
5571-5593
0.001
2
6mer
250423-250444
0.001
1
6mer
95114-95141
0.001
4
6mer
223718-223743
0.001
1
6mer
63289-63304
0.001
2
6mer
137466-137492
0.001
1
6mer
199093-199118
0.001
2
6mer
9037-9055
0.001
2
6mer
223291-223311
0.001
2
6mer
11708-11726
0.001
2
6mer
253599-253624
0.001
2
6mer
30879-30906
0.001
2
6mer
206321-206346
0.001
Not Conserved
6mer
181060-181078
0.001
1
6mer
115107-115132
0.001
2
6mer
77386-77404
0.001
2
6mer
264746-264764
0.001
2
6mer
131319-131345
0.001
Not Conserved
6mer
34879-34902
0.001
1
6mer
109712-109725
0.001
2
6mer
225285-225306
0.001
1
6mer
259562-259580
0.001
2
6mer
259213-259237
0.001
2
7mer
95132-95156
0.001
1
6mer
90985-91005
0.001
2
6mer
24033-24059
0.001
2
6mer
230286-230311
0.001
1
6mer
232465-232483
0.001
1
6mer
212903-212921
0.001
2
6mer
218697-218713
0.001
2
6mer
104578-104603
0.001
3
6mer
229365-229390
0.001
1
6mer
128161-128186
0.001
2
6mer
234924-234944
0.001
1
6mer
18231-18256
0.001
2
6mer
93107-93122
0.001
5
6mer
153583-153603
0.001
2
6mer
225708-225730
0.001
2
6mer
213495-213513
0.001
1
6mer
239270-239292
0.001
1
6mer
241125-241150
0.001
1
6mer
206879-206894
0.001
6
6mer
187320-187338
0.001
1
6mer
135566-135593
0.001
2
6mer
121648-121662
0.001
1
6mer
93250-93275
0.001
1
6mer
249684-249702
0.001
1
6mer
203001-203019
0.001
Not Conserved
6mer
260525-260543
0.001
1
6mer
51750-51768
0.001
2
6mer
192694-192712
0.001
1
6mer
231260-231278
0.001
1
6mer
234499-234517
0.001
1
6mer
122903-122921
0.001
2
6mer
68052-68070
0.001
2
6mer
47034-47059
0.001
3
6mer
117897-117923
0.001
1
6mer
45261-45279
0.001
2
6mer
248108-248126
0.001
1
6mer
263319-263340
0.001
1
6mer
261589-261606
0.001
1
6mer
95599-95619
0.001
1
6mer
74590-74611
0.001
4
6mer
167927-167952
0.001
1
6mer
122961-122978
0.001
3
6mer
61035-61053
0.001
2
6mer
117769-117794
0.001
1
8mer+mismatch
124484-124501
0.001
1
6mer
181367-181385
0.001
Not Conserved
6mer
259255-259280
0.001
2
6mer
182118-182133
0.001
5
6mer
226037-226060
0.001
4
6mer
25585-25605
0.001
1
6mer
228277-228301
0.000
2
6mer
205788-205809
0.000
Not Conserved
6mer
219999-220014
0.000
1
6mer
95661-95674
0.000
2
6mer
6149-6175
0.000
2
6mer
211309-211331
0.000
2
XLOC_013272
hsa-miR-1287-5p
1.000

Gene Details
Chromosome: chr19
Transcript: TCONS_00027233
Biotype: transcript isomorph
Gene id: XLOC_013272
Gene Name: XLOC_013272
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25-44
0.102
1
8mer
98-121
0.083
1
6mer
237-262
0.011
1
6mer
842-867
0.006
1
6mer
1714-1733
0.002
Not Conserved
CTD-2291D10.2
hsa-miR-1287-5p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000565584
Biotype: lincRNA
Gene id: ENSG00000261558
Gene Name: CTD-2291D10.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-47
0.098
1
8mer
101-124
0.083
1
6mer
240-265
0.010
1
6mer
628-653
0.008
1
AC003973.4
hsa-miR-1287-5p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000596778
Biotype: lincRNA
Gene id: ENSG00000269504
Gene Name: AC003973.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
895-920
0.141
1
6mer
57-75
0.012
1
6mer
1138-1157
0.007
1
6mer
713-738
0.006
1
KCNQ1OT1
hsa-miR-1287-5p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
32869-32882
0.013
1
8mer
41834-41860
0.011
1
8mer
28148-28158
0.010
1
7mer
6941-6968
0.009
1
7mer
30119-30138
0.008
1
7mer
53653-53670
0.007
9
8mer
26381-26403
0.006
1
7mer
48136-48158
0.006
6
9mer
19837-19860
0.006
1
7mer
79760-79784
0.004
2
7mer
31138-31152
0.004
1
8mer
28244-28263
0.004
1
6mer
195-215
0.003
1
7mer
67387-67413
0.003
3
6mer
89561-89579
0.003
6
7mer
78861-78877
0.003
2
6mer
66464-66486
0.003
6
7mer
36868-36889
0.002
1
8mer
78328-78351
0.002
1
6mer
46371-46389
0.002
2
8mer+wobble
64481-64499
0.002
2
6mer
41230-41254
0.002
2
6mer
75955-75976
0.002
2
6mer
51126-51141
0.002
3
6mer
74238-74261
0.002
2
6mer
65727-65747
0.001
4
6mer
56519-56543
0.001
5
6mer
11342-11369
0.001
1
6mer
28362-28381
0.001
1
6mer
79538-79556
0.001
2
6mer
30922-30942
0.001
1
6mer
53822-53846
0.001
3
6mer
16970-16991
0.001
2
6mer
18247-18269
0.001
2
6mer
63319-63342
0.001
4
6mer
65982-65997
0.001
3
6mer
45607-45634
0.001
4
6mer
42378-42397
0.001
2
6mer
82816-82839
0.001
2
6mer
59182-59201
0.001
2
6mer
85442-85467
0.001
2
6mer
2939-2959
0.001
2
6mer
12697-12715
0.001
2
6mer
82716-82738
0.001
2
6mer
36658-36680
0.001
1
6mer
80415-80432
0.001
1
6mer
87306-87326
0.001
2
6mer
11936-11961
0.001
2
6mer
54702-54727
0.001
3
6mer
53513-53533
0.001
2
6mer
46346-46365
0.001
2
6mer
65914-65936
0.000
2
6mer
56422-56446
0.000
2
6mer
53786-53807
0.000
3
XLOC_002712
hsa-miR-1287-5p
1.000

Gene Details
Chromosome: chr3
Transcript: TCONS_00006100
Biotype: transcript isomorph
Gene id: XLOC_002712
Gene Name: XLOC_002712
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
63-86
0.135
1
PCAT14
hsa-miR-1287-5p
1.000

Gene Details
Chromosome: 22
Transcript: NR_109832.1
Biotype: lincRNA
Gene id: NR_109832.1 (gene)
Gene Name: PCAT14
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
371-398
0.126
1
6mer
400-422
0.009
1
RP11-728E14.3
hsa-miR-1287-5p
0.999

Gene Details
Chromosome: 17
Transcript: ENST00000577309
Biotype: lincRNA
Gene id: ENSG00000265043
Gene Name: RP11-728E14.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2667-2690
0.124
2
7mer
1270-1293
0.006
1
6mer
800-822
0.005
1
RP3-323A16.1
hsa-miR-1287-5p
0.999

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
53315-53336
0.019
2
8mer
12895-12916
0.018
2
8mer
8552-8576
0.014
1
7mer
6581-6600
0.009
1
7mer
46737-46755
0.006
1
8mer
31555-31579
0.005
2
7mer
44772-44793
0.005
1
7mer
35947-35972
0.005
3
8mer
15920-15945
0.005
2
8mer
8467-8483
0.004
1
7mer
23316-23337
0.004
2
7mer
11753-11773
0.003
1
6mer
42251-42264
0.002
2
6mer
35150-35171
0.002
2
6mer
9149-9170
0.002
2
7mer
14360-14380
0.002
1
6mer
3444-3470
0.002
1
6mer
10967-10985
0.001
2
6mer
48736-48755
0.001
2
6mer
4136-4156
0.001
1
6mer
28466-28490
0.001
2
6mer
8348-8367
0.001
1
6mer
51150-51160
0.001
2
6mer
5817-5837
0.001
1
6mer
52154-52168
0.001
1
7mer
35601-35619
0.001
1
6mer
49568-49580
0.001
2
6mer
23854-23867
0.001
2
6mer
39108-39126
0.001
2
6mer
49083-49102
0.001
2
6mer
4517-4542
0.001
1
6mer
44981-45006
0.001
2
6mer
48163-48181
0.001
1
6mer
24358-24371
0.001
1
6mer
28073-28093
0.001
2
6mer
46830-46849
0.001
2
6mer
15995-16016
0.001
1
6mer
18430-18452
0.001
1
6mer
16114-16139
0.001
2
6mer
50616-50631
0.001
1
6mer
9237-9255
0.001
1
6mer
11052-11070
0.001
2
6mer
42339-42361
0.000
2
XLOC_013265
hsa-miR-1287-5p
0.999

Gene Details
Chromosome: chr19
Transcript: TCONS_00027227
Biotype: transcript isomorph
Gene id: XLOC_013265
Gene Name: XLOC_013265
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
869-893
0.062
1
8mer
796-815
0.052
1
6mer
1260-1279
0.008
1
6mer
1011-1036
0.008
1
LINC01278
hsa-miR-1287-5p
0.999

Gene Details
Chromosome: X
Transcript: ENST00000608623
Biotype: retained_intron
Gene id: ENSG00000235437
Gene Name: LINC01278
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
373-386
0.114
2
7mer
1699-1719
0.005
1
7mer
4166-4190
0.002
Not Conserved
6mer
4601-4625
0.001
Not Conserved
6mer
4242-4258
0.001
Not Conserved
6mer
2718-2735
0.001
Not Conserved
RP11-346C20.3
hsa-miR-1287-5p
0.999

Gene Details
Chromosome: 16
Transcript: ENST00000604855
Biotype: lincRNA
Gene id: ENSG00000271009
Gene Name: RP11-346C20.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1564-1582
0.116
9
6mer
673-684
0.008
11
XLOC_007118
hsa-miR-1287-5p
0.999

Gene Details
Chromosome: chr8
Transcript: TCONS_00015037
Biotype: transcript isomorph
Gene id: XLOC_007118
Gene Name: XLOC_007118
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
4209-4229
0.012
2
6mer
4052-4071
0.011
2
6mer
3996-4015
0.009
2
6mer
115-135
0.007
1
7mer
955-975
0.006
1
7mer
3087-3107
0.005
1
6mer
415-434
0.005
1
6mer
315-334
0.004
1
6mer
266-280
0.004
1
6mer
365-384
0.004
1
6mer
3742-3762
0.004
1
6mer
220-238
0.004
1
6mer
3946-3965
0.004
1
6mer
3690-3710
0.003
1
6mer
660-679
0.003
1
6mer
3351-3370
0.003
1
6mer
613-632
0.003
1
6mer
759-778
0.003
1
6mer
1003-1022
0.002
1
6mer
1199-1222
0.002
1
6mer
3593-3612
0.002
1
6mer
3544-3562
0.002
1
6mer
3298-3318
0.002
1
6mer
3193-3212
0.002
1
6mer
3497-3516
0.002
1
6mer
1541-1560
0.002
1
6mer
3640-3659
0.002
1
6mer
906-925
0.001
1
6mer
2983-3003
0.001
1
6mer
1442-1461
0.001
1
6mer
1829-1845
0.001
1
6mer
2864-2883
0.001
1
6mer
2623-2638
0.001
1
6mer
2523-2541
0.001
1
6mer
1935-1954
0.001
1
6mer
1729-1748
0.001
1
6mer
2770-2789
0.001
1
6mer
1392-1411
0.001
1
6mer
2673-2692
0.001
1
6mer
2723-2742
0.001
1
6mer
2141-2160
0.001
Not Conserved
6mer
2817-2836
0.001
1
6mer
1991-2010
0.000
Not Conserved
6mer
2041-2060
0.000
Not Conserved
6mer
2091-2110
0.000
Not Conserved
XLOC_003050
hsa-miR-1287-5p
0.999

Gene Details
Chromosome: chr3
Transcript: TCONS_00006443
Biotype: transcript isomorph
Gene id: XLOC_003050
Gene Name: XLOC_003050
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
75-96
0.067
2
7mer
336-359
0.038
2
6mer
60-83
0.012
2
RP11-397A16.3
hsa-miR-1287-5p
0.998

Gene Details
Chromosome: 18
Transcript: ENST00000585985
Biotype: lincRNA
Gene id: ENSG00000267172
Gene Name: RP11-397A16.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1658-1684
0.113
2
XLOC_001668
hsa-miR-1287-5p
0.996

Gene Details
Chromosome: chr2
Transcript: TCONS_00003870
Biotype: transcript isomorph
Gene id: XLOC_001668
Gene Name: XLOC_001668
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3029-3045
0.071
2
7mer
2352-2368
0.017
2
6mer
5850-5870
0.006
1
6mer
5372-5390
0.005
1
6mer
1896-1911
0.004
2
CTA-544A11.1
hsa-miR-1287-5p
0.996

Gene Details
Chromosome: 22
Transcript: ENST00000624411
Biotype: antisense
Gene id: ENSG00000279802
Gene Name: CTA-544A11.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2079-2098
0.027
3
7mer
143-160
0.025
6
8mer
11476-11492
0.014
2
8mer
9232-9253
0.010
2
7mer
11672-11689
0.008
1
6mer
119-139
0.005
5
6mer
11299-11319
0.005
5
6mer
8923-8941
0.002
2
6mer
4279-4298
0.002
2
6mer
2840-2862
0.001
1
6mer
4816-4841
0.001
2
6mer
8168-8186
0.001
2
6mer
8622-8642
0.001
2
AC116035.2
hsa-miR-1287-5p
0.996

Gene Details
Chromosome: 3
Transcript: ENST00000431057
Biotype: lincRNA
Gene id: ENSG00000227549
Gene Name: AC116035.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
337-360
0.101
4
CTD-2017D11.1
hsa-miR-1287-5p
0.996

Gene Details
Chromosome: 19
Transcript: ENST00000594934
Biotype: lincRNA
Gene id: ENSG00000268362
Gene Name: CTD-2017D11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
608-633
0.094
2
6mer
1216-1242
0.007
2
RP11-154H23.5
hsa-miR-1287-5p
0.996

Gene Details
Chromosome: 3
Transcript: ENST00000615819
Biotype: antisense
Gene id: ENSG00000274387
Gene Name: RP11-154H23.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
73-96
0.101
6
Funded by: