Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1294

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_012072
hsa-miR-1294
1.000

Gene Details
Chromosome: chr17
Transcript: TCONS_00025267
Biotype: transcript isomorph
Gene id: XLOC_012072
Gene Name: XLOC_012072
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
656-671
0.059
2
8mer
836-851
0.045
1
8mer
34-49
0.043
1
8mer
78-93
0.041
1
8mer
729-744
0.039
1
8mer
137-152
0.038
1
8mer
685-700
0.037
1
8mer
613-628
0.035
1
8mer
627-642
0.034
1
8mer
551-566
0.029
1
7mer
850-866
0.028
1
8mer
822-837
0.028
Not Conserved
7mer
63-79
0.027
1
7mer
48-64
0.026
1
7mer
788-804
0.026
1
7mer
714-730
0.025
1
7mer
773-789
0.025
1
7mer
758-774
0.025
1
7mer
122-138
0.024
1
7mer
743-759
0.024
1
7mer
107-123
0.024
1
7mer
166-182
0.023
1
7mer
151-167
0.023
1
8mer
255-270
0.021
Not Conserved
7mer
699-715
0.018
Not Conserved
8mer
375-390
0.017
Not Conserved
7mer
92-108
0.017
Not Conserved
8mer
389-404
0.017
Not Conserved
7mer
670-686
0.016
Not Conserved
8mer
433-448
0.016
Not Conserved
7mer
641-657
0.016
Not Conserved
8mer
447-462
0.016
Not Conserved
8mer
403-418
0.016
Not Conserved
8mer
492-507
0.015
Not Conserved
7mer
345-361
0.013
Not Conserved
7mer
521-537
0.012
Not Conserved
7mer
332-346
0.012
Not Conserved
7mer
581-599
0.011
Not Conserved
7mer
299-317
0.011
Not Conserved
7mer
477-493
0.011
Not Conserved
7mer
196-211
0.010
Not Conserved
7mer
417-434
0.008
Not Conserved
7mer
506-522
0.007
Not Conserved
7mer
461-478
0.007
Not Conserved
6mer
181-197
0.004
Not Conserved
chr22-38_28785274-29006793.1
hsa-miR-1294
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
559-582
0.009
3
8mer
148946-148968
0.009
2
8mer
201221-201245
0.008
Not Conserved
7mer
148853-148878
0.008
6
8mer
187865-187884
0.008
1
8mer
135343-135359
0.007
2
7mer
227726-227742
0.006
1
7mer
113856-113879
0.006
3
7mer
210101-210121
0.006
7
7mer
185837-185859
0.005
1
7mer
20008-20029
0.004
2
7mer
135806-135821
0.004
1
8mer+wobble
244788-244814
0.004
1
7mer
198408-198424
0.004
3
7mer
57687-57712
0.004
2
7mer
228332-228354
0.004
1
8mer
149120-149145
0.004
3
7mer
89761-89781
0.004
1
7mer
29053-29073
0.004
2
7mer
186277-186298
0.003
3
6mer
2055-2071
0.003
7
7mer
195760-195783
0.003
1
7mer
58207-58232
0.003
3
7mer
228432-228450
0.003
2
7mer
116476-116492
0.003
2
7mer
214594-214609
0.003
4
6mer
116861-116884
0.003
2
7mer
114783-114799
0.003
3
7mer
236180-236199
0.003
Not Conserved
7mer
175655-175679
0.003
3
7mer
232817-232842
0.003
2
6mer
157762-157788
0.003
5
7mer
83730-83746
0.002
2
7mer
265989-265999
0.002
1
7mer
144728-144752
0.002
1
7mer
109788-109813
0.002
1
7mer
75188-75213
0.002
1
6mer
4726-4745
0.002
4
6mer
56968-56987
0.002
9
6mer
210546-210558
0.002
2
6mer
216020-216028
0.002
5
6mer
139323-139338
0.002
6
6mer
41834-41851
0.002
1
6mer
149421-149442
0.002
6
7mer
87148-87165
0.002
2
6mer
255752-255766
0.002
5
6mer
194750-194775
0.002
1
6mer
25734-25760
0.002
2
6mer
66078-66093
0.002
1
7mer
75068-75084
0.002
2
6mer
5290-5314
0.002
2
6mer
132620-132637
0.002
8
6mer
18873-18897
0.002
2
6mer
183359-183382
0.002
5
8mer
28347-28373
0.002
1
6mer
187778-187804
0.002
5
6mer
245863-245878
0.002
1
6mer
152989-153010
0.002
2
6mer
115136-115162
0.002
1
7mer
252617-252635
0.002
1
6mer
235839-235853
0.002
2
6mer
199917-199943
0.002
3
7mer
53250-53267
0.002
2
6mer
74777-74799
0.002
7
6mer
130604-130631
0.002
6
6mer
250097-250124
0.002
Not Conserved
6mer
75897-75909
0.001
1
7mer
125950-125976
0.001
1
6mer
49426-49448
0.001
3
7mer
247730-247756
0.001
1
6mer
30851-30867
0.001
1
6mer
164278-164300
0.001
2
6mer
84073-84080
0.001
2
6mer
188482-188493
0.001
2
6mer
190939-190952
0.001
2
6mer
217615-217631
0.001
2
6mer
235633-235660
0.001
1
6mer
264907-264926
0.001
2
6mer
80044-80055
0.001
1
6mer
132310-132332
0.001
2
6mer
117850-117864
0.001
2
6mer
75496-75513
0.001
3
6mer
60207-60222
0.001
2
6mer
11433-11453
0.001
2
6mer
24934-24958
0.001
2
6mer
66945-66965
0.001
1
6mer
188796-188816
0.001
1
6mer
25355-25369
0.001
1
6mer
9392-9415
0.001
2
6mer
33073-33100
0.001
2
6mer
24073-24097
0.001
2
6mer
62354-62378
0.001
1
6mer
74986-74996
0.001
Not Conserved
6mer
97565-97586
0.001
2
6mer
121030-121038
0.001
2
6mer
88776-88801
0.001
1
6mer
67534-67549
0.001
2
6mer
48770-48790
0.001
2
6mer
91251-91275
0.001
2
6mer
206549-206569
0.001
2
6mer
228010-228034
0.001
Not Conserved
6mer
126671-126681
0.001
1
6mer
90432-90458
0.001
Not Conserved
6mer
260287-260310
0.001
2
6mer
27089-27109
0.001
1
6mer
168323-168346
0.001
1
6mer
192940-192956
0.001
Not Conserved
6mer
87610-87630
0.001
1
6mer
152450-152467
0.001
2
6mer
166227-166250
0.001
3
6mer
61665-61680
0.001
2
6mer
196187-196209
0.001
2
6mer
13996-14015
0.001
1
6mer
32891-32915
0.001
2
6mer
234635-234650
0.001
2
6mer
261176-261188
0.001
2
6mer
95647-95663
0.001
2
6mer
52116-52135
0.001
2
6mer
142557-142582
0.001
3
6mer
201721-201748
0.001
Not Conserved
6mer
232228-232254
0.001
1
6mer
252046-252061
0.001
1
6mer
14141-14160
0.001
2
6mer
225476-225496
0.001
1
6mer
253376-253391
0.001
1
6mer
188146-188161
0.001
2
6mer
236451-236476
0.001
Not Conserved
6mer
215227-215246
0.001
1
6mer
146368-146388
0.001
1
6mer
15214-15229
0.001
1
6mer
239983-240008
0.001
1
6mer
215286-215310
0.001
2
6mer
75128-75144
0.001
1
6mer
188860-188885
0.000
1
6mer
27116-27129
0.000
3
6mer
88801-88821
0.000
2
RP13-580B18.4
hsa-miR-1294
1.000

Gene Details
Chromosome: 7
Transcript: ENST00000624628
Biotype: lincRNA
Gene id: ENSG00000279072
Gene Name: RP13-580B18.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
43-62
0.019
1
7mer
23639-23660
0.007
Not Conserved
7mer
23671-23690
0.006
Not Conserved
8mer
22461-22480
0.006
Not Conserved
7mer
20844-20863
0.004
1
7mer
23001-23020
0.004
1
7mer
21513-21528
0.004
Not Conserved
7mer
23534-23553
0.004
1
6mer
23703-23722
0.004
1
7mer
22711-22730
0.004
1
7mer
22933-22956
0.004
1
7mer
1154-1172
0.004
Not Conserved
7mer
3544-3567
0.004
1
7mer
20117-20136
0.004
1
7mer
10800-10823
0.004
1
7mer
18968-18987
0.003
1
8mer
19545-19566
0.003
1
6mer
141-158
0.003
1
7mer
22041-22056
0.003
1
7mer
19804-19825
0.003
1
7mer
7076-7099
0.003
Not Conserved
7mer
16371-16394
0.003
Not Conserved
7mer
5286-5309
0.003
Not Conserved
7mer
12782-12805
0.003
Not Conserved
7mer
8962-8985
0.003
Not Conserved
7mer
14629-14652
0.003
Not Conserved
7mer
20592-20609
0.003
1
7mer
3677-3696
0.003
1
7mer
12915-12934
0.002
1
7mer
21250-21269
0.002
1
7mer
18831-18854
0.002
Not Conserved
7mer
1291-1310
0.002
Not Conserved
7mer
15618-15638
0.002
Not Conserved
7mer
18209-18227
0.002
Not Conserved
7mer
8209-8229
0.002
Not Conserved
7mer
22166-22185
0.002
Not Conserved
7mer
16504-16523
0.002
Not Conserved
7mer
2794-2814
0.002
Not Conserved
7mer
10047-10067
0.002
Not Conserved
7mer
12029-12049
0.002
Not Conserved
7mer
6323-6343
0.002
Not Conserved
7mer
13867-13887
0.002
Not Conserved
7mer
14762-14781
0.002
Not Conserved
6mer
816-836
0.002
1
7mer
7209-7228
0.002
Not Conserved
7mer
22586-22605
0.002
Not Conserved
7mer
10933-10952
0.002
Not Conserved
7mer
18346-18365
0.002
Not Conserved
7mer
9095-9114
0.002
Not Conserved
7mer
21096-21123
0.002
1
7mer
19640-19661
0.002
1
7mer
5419-5438
0.001
Not Conserved
7mer
21812-21831
0.001
Not Conserved
7mer
22298-22317
0.001
Not Conserved
7mer
4485-4509
0.001
Not Conserved
7mer
21912-21931
0.001
Not Conserved
6mer
20715-20736
0.001
1
7mer
17456-17476
0.001
Not Conserved
7mer
11789-11813
0.001
1
7mer
9951-9975
0.001
1
7mer
11933-11957
0.001
1
7mer
13819-13843
0.001
1
7mer
17408-17432
0.001
Not Conserved
6mer
22394-22412
0.001
Not Conserved
7mer
2698-2722
0.001
Not Conserved
7mer
15570-15594
0.001
Not Conserved
6mer
10543-10562
0.001
1
7mer
8113-8137
0.001
Not Conserved
7mer
8065-8089
0.001
Not Conserved
7mer
17216-17240
0.001
Not Conserved
6mer
14374-14393
0.001
Not Conserved
7mer
8017-8041
0.001
Not Conserved
7mer
15474-15500
0.001
Not Conserved
6mer
17952-17971
0.001
Not Conserved
6mer
6819-6838
0.001
Not Conserved
7mer
17360-17384
0.001
Not Conserved
7mer
8161-8185
0.001
Not Conserved
7mer
9999-10023
0.001
Not Conserved
7mer
6131-6155
0.001
Not Conserved
7mer
6275-6299
0.001
Not Conserved
7mer
4437-4461
0.001
Not Conserved
7mer
11981-12005
0.001
Not Conserved
6mer
6458-6477
0.001
1
7mer
13771-13794
0.001
Not Conserved
7mer
13723-13746
0.001
Not Conserved
7mer
11741-11764
0.001
Not Conserved
7mer
7969-7993
0.001
Not Conserved
7mer
13627-13651
0.001
Not Conserved
7mer
7921-7945
0.001
Not Conserved
7mer
17264-17288
0.001
Not Conserved
7mer
11693-11717
0.001
Not Conserved
7mer
11645-11669
0.001
Not Conserved
7mer
13675-13699
0.001
Not Conserved
7mer
9807-9831
0.001
Not Conserved
7mer
11885-11909
0.001
Not Conserved
7mer
11837-11861
0.001
Not Conserved
7mer
15522-15546
0.001
Not Conserved
7mer
17312-17336
0.001
Not Conserved
7mer
6227-6251
0.001
Not Conserved
7mer
9855-9879
0.001
Not Conserved
7mer
6179-6203
0.001
Not Conserved
7mer
9903-9927
0.001
Not Conserved
6mer
16114-16133
0.001
Not Conserved
6mer
1826-1845
0.001
Not Conserved
6mer
8705-8724
0.001
Not Conserved
6mer
19704-19723
0.001
1
6mer
22680-22693
0.001
1
6mer
12525-12544
0.001
Not Conserved
6mer
2469-2488
0.001
Not Conserved
6mer
16987-17006
0.001
Not Conserved
6mer
15245-15264
0.001
Not Conserved
6mer
4160-4179
0.001
Not Conserved
6mer
5902-5921
0.001
Not Conserved
6mer
9578-9597
0.001
Not Conserved
6mer
13398-13417
0.001
Not Conserved
6mer
7692-7711
0.001
Not Conserved
6mer
17591-17610
0.001
Not Conserved
6mer
11416-11435
0.001
Not Conserved
6mer
12164-12183
0.000
Not Conserved
6mer
14002-14021
0.000
Not Conserved
6mer
20646-20664
0.000
1
6mer
4352-4369
0.000
1
6mer
2929-2948
0.000
Not Conserved
6mer
8344-8363
0.000
Not Conserved
6mer
4668-4687
0.000
Not Conserved
6mer
20678-20700
0.000
1
6mer
10182-10201
0.000
Not Conserved
6mer
21780-21794
0.000
Not Conserved
6mer
15753-15772
0.000
Not Conserved
6mer
22901-22920
0.000
Not Conserved
6mer
22010-22028
0.000
1
6mer
1256-1273
0.000
Not Conserved
6mer
9770-9787
0.000
Not Conserved
6mer
13590-13607
0.000
Not Conserved
6mer
2661-2679
0.000
Not Conserved
6mer
11608-11625
0.000
Not Conserved
6mer
15437-15454
0.000
Not Conserved
6mer
6094-6111
0.000
Not Conserved
6mer
7884-7901
0.000
Not Conserved
6mer
17179-17196
0.000
Not Conserved
6mer
2746-2770
0.000
Not Conserved
6mer
18933-18951
0.000
1
6mer
4390-4413
0.000
Not Conserved
6mer
18311-18328
0.000
Not Conserved
RP11-352B15.2
hsa-miR-1294
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000564385
Biotype: lincRNA
Gene id: ENSG00000260611
Gene Name: RP11-352B15.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1042-1067
0.182
1
6mer
762-783
0.008
1
XLOC_013011
hsa-miR-1294
1.000

Gene Details
Chromosome: chr19
Transcript: TCONS_00026953
Biotype: transcript isomorph
Gene id: XLOC_013011
Gene Name: XLOC_013011
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
97-119
0.162
1
8mer+wobble
343-362
0.020
1
RP11-219A15.2
hsa-miR-1294
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000582895
Biotype: lincRNA
Gene id: ENSG00000264729
Gene Name: RP11-219A15.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
78-100
0.156
1
6mer
237-255
0.016
1
RP11-378J18.9
hsa-miR-1294
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000619187
Biotype: lincRNA
Gene id: ENSG00000276997
Gene Name: RP11-378J18.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
188-209
0.169
2
RP11-434D2.2
hsa-miR-1294
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000583863
Biotype: lincRNA
Gene id: ENSG00000265556
Gene Name: RP11-434D2.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
78-100
0.152
1
6mer
237-255
0.015
1
XLOC_006111
hsa-miR-1294
1.000

Gene Details
Chromosome: chr7
Transcript: TCONS_00013454
Biotype: transcript isomorph
Gene id: XLOC_006111
Gene Name: XLOC_006111
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
917-936
0.153
2
6mer
8-35
0.009
1
XLOC_003663
hsa-miR-1294
1.000

Gene Details
Chromosome: chr4
Transcript: TCONS_00008208
Biotype: transcript isomorph
Gene id: XLOC_003663
Gene Name: XLOC_003663
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
88-102
0.155
2
MEG3
hsa-miR-1294
1.000

Gene Details
Chromosome: 14
Transcript: ENST00000398460
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3269-3292
0.083
6
8mer
99-122
0.060
5
7mer
663-681
0.008
1
6mer
1173-1195
0.001
2
6mer
2031-2055
0.001
1
CTD-3116E22.8
hsa-miR-1294
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000613300
Biotype: lincRNA
Gene id: ENSG00000277587
Gene Name: CTD-3116E22.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
455-477
0.149
1
XLOC_007597
hsa-miR-1294
1.000

Gene Details
Chromosome: chr9
Transcript: TCONS_00016207
Biotype: transcript isomorph
Gene id: XLOC_007597
Gene Name: XLOC_007597
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
352-369
0.133
2
6mer
56-75
0.007
2
6mer
103-112
0.005
1
XXbac-BPG254F23.7
hsa-miR-1294
1.000

Gene Details
Chromosome: 6
Transcript: ENST00000458375
Biotype: lincRNA
Gene id: ENSG00000232080
Gene Name: XXbac-BPG254F23.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
197-223
0.143
1
RP11-619L12.4
hsa-miR-1294
1.000

Gene Details
Chromosome: 5
Transcript: ENST00000519942
Biotype: antisense
Gene id: ENSG00000253447
Gene Name: RP11-619L12.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
35-48
0.139
4
XLOC_007865
hsa-miR-1294
0.999

Gene Details
Chromosome: chr9
Transcript: TCONS_00016487
Biotype: transcript isomorph
Gene id: XLOC_007865
Gene Name: XLOC_007865
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1074-1087
0.033
1
9mer
1227-1240
0.030
1
9mer
941-954
0.017
2
9mer
1014-1027
0.016
1
7mer
1172-1193
0.008
2
7mer
902-929
0.008
2
7mer
1162-1185
0.006
1
7mer
983-1000
0.005
1
6mer
1477-1495
0.004
1
6mer
563-584
0.002
1
6mer
850-875
0.002
2
6mer
876-893
0.002
3
LINC00999
hsa-miR-1294
0.999

Gene Details
Chromosome: 10
Transcript: NR_024497.2
Biotype: lincRNA
Gene id: NR_024497.2 (gene)
Gene Name: LINC00999
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
384-405
0.042
2
7mer
4975-4994
0.011
Not Conserved
7mer
1032-1053
0.007
2
7mer
1482-1505
0.007
2
7mer
1768-1787
0.007
1
7mer
4879-4896
0.004
1
6mer
970-989
0.004
2
7mer
4842-4861
0.004
1
7mer
1139-1158
0.003
2
6mer
267-282
0.003
1
7mer
3232-3257
0.003
2
7mer
1255-1276
0.002
Not Conserved
7mer
1002-1021
0.002
1
7mer
3085-3110
0.002
1
6mer
4373-4392
0.002
1
7mer
2987-3012
0.001
1
7mer
3477-3502
0.001
1
7mer
2841-2865
0.001
1
7mer
3379-3404
0.001
1
7mer
3330-3355
0.001
1
7mer
3767-3793
0.001
Not Conserved
7mer
2450-2475
0.001
1
7mer
3281-3306
0.001
1
7mer
2938-2963
0.001
1
7mer
3134-3159
0.001
1
7mer
3622-3647
0.001
1
7mer
3183-3208
0.001
1
7mer
2405-2428
0.001
Not Conserved
7mer
2548-2572
0.001
1
7mer
2644-2669
0.001
Not Conserved
7mer
3529-3549
0.001
Not Conserved
7mer
2742-2767
0.001
Not Conserved
7mer
3573-3598
0.001
Not Conserved
7mer
2791-2816
0.001
Not Conserved
7mer
3428-3453
0.001
Not Conserved
7mer
2890-2914
0.001
Not Conserved
7mer
3720-3745
0.001
Not Conserved
7mer
2499-2523
0.001
Not Conserved
6mer
1289-1307
0.001
1
6mer
1518-1537
0.001
1
8mer+wobble
3671-3696
0.001
Not Conserved
6mer
2291-2314
0.001
Not Conserved
6mer
1867-1886
0.001
1
RP11-697N18.4
hsa-miR-1294
0.999

Gene Details
Chromosome: 8
Transcript: ENST00000602578
Biotype: sense_intronic
Gene id: ENSG00000269924
Gene Name: RP11-697N18.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
672-696
0.128
2
RP11-675P14.1
hsa-miR-1294
0.999

Gene Details
Chromosome: 18
Transcript: ENST00000583089
Biotype: lincRNA
Gene id: ENSG00000266196
Gene Name: RP11-675P14.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
378-390
0.125
5
RP5-1121A15.3
hsa-miR-1294
0.999

Gene Details
Chromosome: 7
Transcript: ENST00000427073
Biotype: lincRNA
Gene id: ENSG00000230033
Gene Name: RP5-1121A15.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1294
Sequence: ugugagguuggcauuguugucu
MirBase ID: MIMAT0005884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
164-183
0.124
1
Funded by: