Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-1302
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
117596-117611
0.010
1
8mer
88982-89005
0.010
2
8mer
136287-136297
0.006
1
8mer
178689-178715
0.005
2
7mer
1024-1049
0.005
1
8mer
93563-93585
0.005
2
7mer
55643-55665
0.004
1
7mer
126658-126672
0.004
4
7mer
190647-190669
0.004
1
7mer
135481-135498
0.004
2
7mer
44642-44657
0.004
1
7mer
242650-242666
0.004
1
7mer
25773-25783
0.004
2
7mer
258230-258249
0.004
1
7mer
129047-129062
0.004
5
7mer
124199-124212
0.003
2
7mer
116411-116433
0.003
3
6mer
111478-111482
0.003
9
7mer
15913-15937
0.003
2
7mer
87043-87060
0.003
2
7mer
128869-128880
0.003
3
7mer
134671-134685
0.003
1
7mer
231172-231192
0.003
1
7mer
199246-199272
0.003
2
7mer
53529-53552
0.003
3
7mer
29978-29991
0.002
2
7mer
115697-115714
0.002
2
6mer
130442-130463
0.002
7
7mer
165769-165774
0.002
2
7mer
208571-208581
0.002
3
7mer
66900-66921
0.002
2
7mer
143506-143520
0.002
2
6mer
249839-249855
0.002
1
6mer
121977-121991
0.002
3
6mer
122661-122676
0.002
2
6mer
264839-264843
0.002
1
7mer
214413-214439
0.002
1
6mer
69382-69395
0.002
3
7mer
219462-219483
0.002
1
6mer
232046-232050
0.002
1
6mer
188480-188484
0.002
3
6mer
156653-156672
0.002
2
6mer
266554-266574
0.002
2
6mer
125667-125671
0.002
2
7mer
143438-143452
0.002
1
6mer
200018-200029
0.002
4
6mer
188679-188700
0.002
2
6mer
200490-200507
0.002
2
6mer
64838-64851
0.002
2
6mer
113973-113992
0.002
3
7mer
206855-206872
0.002
2
6mer
192852-192865
0.002
1
6mer
24237-24241
0.002
2
6mer
124004-124015
0.002
3
6mer
5097-5105
0.002
2
6mer
77116-77135
0.002
1
6mer
203336-203361
0.002
2
7mer
99069-99089
0.002
1
6mer
139149-139164
0.002
3
6mer
131322-131326
0.002
2
6mer
176476-176495
0.002
1
8mer
264887-264893
0.002
2
6mer
237440-237463
0.002
3
6mer
243801-243827
0.002
2
6mer
181809-181817
0.002
4
6mer
64245-64249
0.002
2
6mer
263772-263776
0.002
2
6mer
201928-201932
0.002
Not Conserved
6mer
174191-174216
0.002
2
6mer
155053-155068
0.002
2
6mer
155641-155656
0.001
1
6mer
95556-95582
0.001
2
6mer
218511-218515
0.001
2
6mer
104900-104904
0.001
2
6mer
219217-219221
0.001
2
6mer
13608-13623
0.001
1
6mer
50275-50290
0.001
1
6mer
145903-145912
0.001
1
6mer
22072-22076
0.001
3
6mer
103009-103036
0.001
2
6mer
157464-157491
0.001
1
6mer
176285-176289
0.001
2
6mer
133200-133226
0.001
2
6mer
142161-142186
0.001
2
6mer
165910-165936
0.001
3
6mer
244171-244181
0.001
2
6mer
63604-63608
0.001
2
6mer
160874-160899
0.001
2
6mer
227372-227398
0.001
2
6mer
253990-254000
0.001
2
8mer
265269-265291
0.001
2
6mer
44017-44021
0.001
2
6mer
95038-95042
0.001
2
6mer
170164-170174
0.001
2
6mer
247247-247251
0.001
1
6mer
259039-259054
0.001
2
6mer
177145-177149
0.001
2
6mer
229000-229026
0.001
1
6mer
82991-83010
0.001
5
6mer
5882-5898
0.001
2
6mer
17893-17903
0.001
2
6mer
76663-76687
0.001
2
6mer
226058-226077
0.001
2
6mer
129947-129957
0.001
2
6mer
112675-112700
0.001
1
6mer
169595-169608
0.001
1
6mer
71507-71533
0.001
2
6mer
145473-145493
0.001
Not Conserved
6mer
238165-238185
0.001
1
6mer
164680-164684
0.001
1
6mer
85205-85220
0.001
1
6mer
68853-68868
0.001
1
6mer
26612-26627
0.001
2
6mer
134899-134913
0.001
2
6mer
265248-265264
0.001
5
6mer
133789-133793
0.001
2
6mer
127855-127865
0.001
1
6mer
228719-228744
0.001
2
6mer
138445-138470
0.001
1
6mer
152091-152117
0.001
2
6mer
255510-255536
0.001
2
6mer
177821-177836
0.001
2
6mer
258343-258353
0.001
3
6mer
91409-91413
0.001
1
6mer
31035-31039
0.001
2
6mer
136617-136621
0.001
2
6mer
105630-105640
0.001
2
6mer
236469-236489
0.001
2
6mer
137981-138007
0.001
1
6mer
90317-90321
0.001
1
6mer
98828-98845
0.001
4
6mer
156813-156823
0.001
2
6mer
70839-70849
0.001
2
6mer
31951-31970
0.001
2
6mer
18080-18090
0.001
2
6mer
221839-221857
0.001
2
6mer
180973-180993
0.001
2
6mer
157074-157095
0.001
2
6mer
65811-65836
0.001
1
6mer
80570-80595
0.001
1
6mer
256779-256795
0.001
1
6mer
138682-138690
0.001
2
6mer
182032-182042
0.001
3
8mer+wobble
265877-265900
0.001
1
6mer
158364-158390
0.001
2
6mer
108826-108830
0.001
1
6mer
261256-261282
0.001
1
6mer
82723-82740
0.001
3
6mer
252754-252779
0.001
2
6mer
42900-42904
0.001
1
6mer
247563-247576
0.001
1
6mer
100795-100799
0.001
Not Conserved
6mer
27340-27365
0.001
1
6mer
153362-153382
0.001
1
6mer
126001-126027
0.001
1
6mer
91544-91548
0.001
2
6mer
148831-148846
0.001
2
6mer
259475-259496
0.001
2
6mer
145312-145326
0.001
3
6mer
187232-187252
0.001
1
6mer
12344-12366
0.001
2
6mer
244762-244772
0.001
1
6mer
115390-115414
0.001
1
6mer
193457-193475
0.001
Not Conserved
6mer
65989-65999
0.001
1
6mer
194393-194418
0.001
2
6mer
46180-46207
0.001
2
6mer
140424-140444
0.001
2
7mer
188737-188748
0.001
2
6mer
77657-77682
0.001
1
6mer
174552-174578
0.001
1
6mer
115533-115537
0.001
2
6mer
154142-154152
0.001
1
6mer
133918-133928
0.001
2
6mer
6740-6759
0.001
2
6mer
50400-50420
0.001
2
6mer
19034-19038
0.001
2
6mer
73375-73390
0.001
1
6mer
126157-126161
0.001
2
6mer
167850-167865
0.001
2
6mer
134428-134439
0.001
2
6mer
99241-99253
0.001
1
6mer
36218-36237
0.001
1
7mer
115554-115578
0.001
1
6mer
138146-138150
0.001
1
6mer
14591-14611
0.001
2
6mer
41607-41632
0.001
1
6mer
130067-130093
0.001
2
6mer
53347-53363
0.001
2
6mer
74278-74300
0.001
1
6mer
27853-27873
0.001
1
6mer
263227-263254
0.001
1
6mer
105742-105767
0.001
2
6mer
253517-253538
0.001
2
6mer
202917-202933
0.001
Not Conserved
6mer
115026-115046
0.001
1
6mer
260438-260458
0.001
2
6mer
178846-178850
0.001
1
6mer
137490-137504
0.001
2
6mer
206398-206417
0.001
2
6mer
205972-205982
0.001
1
6mer
73185-73205
0.001
1
6mer
30192-30213
0.001
2
6mer
112829-112833
0.001
1
6mer
45167-45187
0.001
2
6mer
37583-37610
0.001
1
6mer
194921-194941
0.001
3
6mer
77759-77784
0.001
1
6mer
123088-123092
0.001
Not Conserved
6mer
41742-41768
0.001
2
6mer
63714-63733
0.001
2
6mer
157615-157625
0.001
2
6mer
256892-256912
0.001
Not Conserved
6mer
18200-18226
0.001
2
6mer
14420-14440
0.001
1
6mer
121269-121289
0.001
1
6mer
117733-117743
0.001
3
6mer
206242-206259
0.001
Not Conserved
6mer
137150-137155
0.001
1
6mer
138818-138822
0.001
1
6mer
112916-112926
0.001
1
6mer
211623-211642
0.001
1
6mer
161029-161033
0.001
2
6mer
181279-181299
0.001
Not Conserved
6mer
43030-43040
0.001
1
6mer
26681-26698
0.001
2
6mer
194527-194553
0.001
1
6mer
224387-224401
0.001
Not Conserved
6mer
213412-213427
0.001
1
6mer
109624-109644
0.001
1
6mer
218593-218608
0.001
2
6mer
177276-177280
0.001
2
6mer
85328-85355
0.001
2
6mer
27495-27499
0.001
1
6mer
44671-44697
0.001
1
6mer
265354-265368
0.000
3
6mer
77812-77816
0.000
1
6mer
165767-165781
0.000
2
RP11-211N8.2
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000446626
Biotype: lincRNA
Gene id: ENSG00000226007
Gene Name: RP11-211N8.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
167-191
0.171
2
7mer
2152-2177
0.039
2
6mer
316-337
0.013
2
6mer
225-240
0.010
2
RP11-211N8.2
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000450704
Biotype: lincRNA
Gene id: ENSG00000226007
Gene Name: RP11-211N8.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
194-218
0.169
2
7mer
1454-1479
0.039
2
6mer
343-364
0.013
2
6mer
252-267
0.010
2
XLOC_008329
hsa-miR-1302
1.000

Gene Details
Chromosome: chrY
Transcript: TCONS_00017592
Biotype: transcript isomorph
Gene id: XLOC_008329
Gene Name: XLOC_008329
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
492-500
0.212
1
6mer
219-232
0.014
1
GLIDR
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000476224
Biotype: lincRNA
Gene id: ENSG00000170161
Gene Name: GLIDR
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
125-149
0.158
1
7mer
1385-1410
0.042
1
6mer
274-295
0.014
1
6mer
183-198
0.011
1
RP11-111F5.4
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000429818
Biotype: lincRNA
Gene id: ENSG00000204802
Gene Name: RP11-111F5.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1332-1356
0.149
1
7mer
71-96
0.042
1
6mer
1186-1207
0.014
1
6mer
1283-1298
0.010
1
RP11-111F5.4
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000377518
Biotype: retained_intron
Gene id: ENSG00000204802
Gene Name: RP11-111F5.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2390-2414
0.148
1
7mer
405-430
0.033
1
6mer
2244-2265
0.014
1
6mer
2341-2356
0.010
1
GLIDR
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: NR_015363.1
Biotype: lincRNA
Gene id: NR_015363.1 (gene)
Gene Name: GLIDR
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2388-2412
0.147
2
7mer
385-410
0.033
2
6mer
2224-2228
0.014
2
6mer
2339-2354
0.010
2
XLOC_007690
hsa-miR-1302
1.000

Gene Details
Chromosome: chr9
Transcript: TCONS_00015562
Biotype: transcript isomorph
Gene id: XLOC_007690
Gene Name: XLOC_007690
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2787-2811
0.146
2
7mer
747-772
0.026
2
6mer
2586-2590
0.014
2
6mer
2738-2753
0.010
2
AC004510.3
hsa-miR-1302
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000587970
Biotype: lincRNA
Gene id: ENSG00000267308
Gene Name: AC004510.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
35-56
0.175
2
RP11-111F5.4
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000430302
Biotype: lincRNA
Gene id: ENSG00000204802
Gene Name: RP11-111F5.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
577-601
0.146
1
6mer
316-320
0.016
1
6mer
528-543
0.010
1
RP5-867C24.5
hsa-miR-1302
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000572193
Biotype: antisense
Gene id: ENSG00000261872
Gene Name: RP5-867C24.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
95-107
0.145
10
XLOC_004504
hsa-miR-1302
1.000

Gene Details
Chromosome: chr5
Transcript: TCONS_00010056
Biotype: transcript isomorph
Gene id: XLOC_004504
Gene Name: XLOC_004504
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
190-202
0.139
9
RP11-312B8.1
hsa-miR-1302
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000442889
Biotype: antisense
Gene id: ENSG00000237436
Gene Name: RP11-312B8.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
7-17
0.139
6
LINC01410
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000424345
Biotype: lincRNA
Gene id: ENSG00000238113
Gene Name: LINC01410
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2356-2372
0.139
1
RP11-327I22.5
hsa-miR-1302
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000621949
Biotype: lincRNA
Gene id: ENSG00000278849
Gene Name: RP11-327I22.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
317-340
0.125
1
8mer
421-435
0.011
Not Conserved
XLOC_007710
hsa-miR-1302
0.999

Gene Details
Chromosome: chr9
Transcript: TCONS_00015825
Biotype: transcript isomorph
Gene id: XLOC_007710
Gene Name: XLOC_007710
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
508-524
0.133
1
AC073254.1
hsa-miR-1302
0.999

Gene Details
Chromosome: 2
Transcript: ENST00000617813
Biotype: antisense
Gene id: ENSG00000237126
Gene Name: AC073254.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
117-124
0.127
7
6mer
245-260
0.006
6
RP11-764K9.1
hsa-miR-1302
0.999

Gene Details
Chromosome: 9
Transcript: ENST00000417843
Biotype: lincRNA
Gene id: ENSG00000225411
Gene Name: RP11-764K9.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
508-524
0.133
1
XLOC_007861
hsa-miR-1302
0.999

Gene Details
Chromosome: chr9
Transcript: TCONS_00016482
Biotype: transcript isomorph
Gene id: XLOC_007861
Gene Name: XLOC_007861
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
77-101
0.068
2
7mer
171-196
0.059
2
Funded by: