Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-145-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
MUC19
hsa-miR-145-5p
1.000

Gene Details
Chromosome: 12
Transcript: ENST00000454784
Biotype: processed_transcript
Gene id: ENSG00000205592
Gene Name: MUC19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
12851-12869
0.009
1
8mer
11627-11647
0.008
1
8mer
4239-4255
0.007
2
9mer
10310-10330
0.007
Not Conserved
8mer
22144-22161
0.006
1
8mer
23816-23841
0.006
2
8mer
16924-16946
0.006
1
8mer
6812-6838
0.006
2
8mer
13897-13916
0.005
1
8mer
12053-12064
0.005
2
7mer
10518-10539
0.005
1
8mer
16657-16676
0.005
1
9mer
12074-12094
0.005
Not Conserved
7mer
17681-17704
0.005
1
8mer
11804-11827
0.005
1
8mer
15692-15716
0.005
1
9mer
9323-9340
0.004
2
8mer
9440-9460
0.004
2
8mer
14677-14696
0.004
1
8mer
16834-16856
0.004
Not Conserved
8mer
12909-12929
0.004
1
9mer
10160-10180
0.004
Not Conserved
8mer
17613-17636
0.004
1
8mer
6989-7009
0.004
2
9mer
11126-11137
0.004
1
9mer
18102-18113
0.004
1
8mer
10640-10660
0.004
1
8mer
7764-7786
0.004
1
8mer
7286-7309
0.004
3
8mer
13418-13436
0.004
1
8mer
12521-12539
0.004
Not Conserved
7mer
20683-20707
0.003
2
8mer
13029-13049
0.003
1
8mer
18211-18233
0.003
1
7mer
9230-9249
0.003
2
8mer
17853-17873
0.003
1
8mer
11505-11527
0.003
1
8mer
17014-17036
0.003
1
8mer
8990-9007
0.003
2
8mer
17224-17246
0.003
Not Conserved
8mer
15304-15326
0.003
2
7mer
10969-10986
0.003
Not Conserved
7mer
5233-5253
0.003
4
7mer
6851-6867
0.003
2
8mer
8183-8203
0.003
2
9mer
17385-17396
0.003
Not Conserved
8mer
8216-8233
0.003
3
8mer
14886-14906
0.003
Not Conserved
8mer
16056-16076
0.003
1
8mer
10730-10750
0.003
1
9mer
16357-16376
0.003
Not Conserved
6mer
23704-23724
0.003
2
8mer
7919-7933
0.003
2
8mer
17196-17216
0.003
1
8mer
14136-14156
0.002
Not Conserved
8mer
11057-11077
0.002
1
9mer
8633-8650
0.002
Not Conserved
6mer
1389-1409
0.002
6
8mer
15246-15266
0.002
1
8mer
9989-10000
0.002
1
8mer
11895-11914
0.002
1
7mer
8573-8590
0.002
1
7mer
11865-11884
0.002
Not Conserved
8mer
11756-11767
0.002
1
8mer
17526-17546
0.002
1
8mer
10070-10090
0.002
1
8mer
15876-15896
0.002
1
6mer
20271-20286
0.002
3
8mer
11477-11497
0.002
Not Conserved
8mer
16035-16046
0.002
2
8mer
15158-15176
0.002
Not Conserved
8mer
11357-11377
0.002
1
8mer
12581-12599
0.002
1
8mer
17436-17456
0.002
2
7mer
7679-7695
0.002
2
8mer
11537-11557
0.002
Not Conserved
7mer
12194-12214
0.002
Not Conserved
8mer
11954-11974
0.002
1
8mer
17136-17156
0.002
1
7mer
7051-7068
0.002
2
8mer
15039-15056
0.002
1
8mer
10997-11017
0.002
1
8mer
10040-10060
0.002
2
9mer
11088-11107
0.002
Not Conserved
8mer
18063-18083
0.002
2
8mer
17256-17276
0.002
Not Conserved
8mer
16209-16226
0.002
Not Conserved
8mer
8750-8770
0.002
2
8mer
8339-8353
0.002
2
7mer
22496-22513
0.002
2
8mer
7317-7339
0.002
2
8mer
11687-11707
0.002
1
8mer
11147-11167
0.002
2
8mer
12880-12899
0.002
1
8mer
8033-8053
0.002
2
8mer
11417-11437
0.002
Not Conserved
7mer
13149-13168
0.002
2
8mer
11715-11737
0.002
1
7mer
5468-5482
0.002
2
7mer
9647-9670
0.002
2
8mer
17076-17096
0.002
Not Conserved
8mer
15934-15956
0.002
Not Conserved
8mer
6368-6388
0.002
1
6mer
7524-7546
0.002
2
7mer
18273-18293
0.002
1
7mer
10337-10360
0.002
Not Conserved
7mer
21145-21169
0.002
2
7mer
9080-9100
0.002
3
8mer
14046-14066
0.002
1
8mer
7172-7189
0.002
2
8mer
15846-15866
0.002
1
8mer
15276-15296
0.002
Not Conserved
7mer
18123-18143
0.002
3
7mer
9263-9280
0.002
2
8mer
17892-17903
0.002
1
7mer
6551-6568
0.002
1
6mer
23512-23529
0.002
3
6mer
6273-6298
0.002
3
8mer
12940-12959
0.002
Not Conserved
6mer
22982-23007
0.002
2
8mer
13566-13586
0.002
2
8mer
17406-17426
0.002
Not Conserved
8mer
14025-14036
0.002
1
8mer
6671-6688
0.002
1
6mer
21059-21081
0.002
2
8mer
14826-14846
0.002
1
8mer
12252-12274
0.002
2
8mer
5488-5505
0.002
1
8mer
17565-17576
0.002
1
6mer
18713-18736
0.002
2
7mer
18388-18409
0.001
1
8mer
10220-10240
0.001
3
8mer
6632-6658
0.001
2
8mer
10670-10690
0.001
Not Conserved
8mer
8843-8860
0.001
1
8mer
15825-15836
0.001
1
7mer
9773-9793
0.001
1
7mer
14316-14336
0.001
1
7mer
13446-13465
0.001
1
8mer
17736-17753
0.001
1
7mer
7232-7248
0.001
2
6mer
21569-21591
0.001
2
8mer
8653-8680
0.001
1
8mer
6461-6478
0.001
2
8mer
14235-14246
0.001
1
7mer
9562-9580
0.001
1
6mer
21814-21831
0.001
2
8mer
16416-16436
0.001
1
6mer
19793-19818
0.001
2
8mer
13476-13496
0.001
1
6mer
23213-23238
0.001
2
7mer
10247-10269
0.001
3
7mer
15336-15356
0.001
1
8mer
6902-6919
0.001
1
7mer
18162-18173
0.001
1
8mer
12609-12629
0.001
2
6mer
4336-4349
0.001
4
6mer
19230-19249
0.001
2
8mer
13659-13676
0.001
3
6mer
22379-22395
0.001
1
7mer
10787-10810
0.001
1
7mer
8366-8382
0.001
1
8mer
12667-12689
0.001
Not Conserved
7mer
22634-22654
0.001
2
7mer
14916-14936
0.001
Not Conserved
8mer
10552-10570
0.001
2
8mer
13188-13199
0.001
Not Conserved
6mer
5693-5715
0.001
3
8mer
10709-10720
0.001
1
6mer
9628-9652
0.001
2
7mer
16086-16106
0.001
Not Conserved
7mer
13087-13109
0.001
1
7mer
13278-13289
0.001
Not Conserved
6mer
20485-20508
0.001
2
6mer
7970-7993
0.001
3
7mer
12224-12244
0.001
1
8mer
8066-8083
0.001
2
6mer
23765-23788
0.001
2
8mer
14470-14486
0.001
1
8mer
16476-16496
0.001
1
8mer
17046-17066
0.001
1
7mer
6430-6448
0.001
1
8mer
13630-13646
0.001
Not Conserved
6mer
20839-20862
0.001
2
8mer+wobble
11027-11047
0.001
Not Conserved
8mer
14166-14186
0.001
1
8mer
13599-13616
0.001
1
8mer
16266-16286
0.001
Not Conserved
8mer
16956-16976
0.001
1
7mer
12284-12304
0.001
Not Conserved
8mer
10010-10030
0.001
1
8mer
13690-13706
0.001
Not Conserved
8mer
15490-15506
0.001
1
7mer
10578-10600
0.001
1
7mer
12353-12364
0.001
Not Conserved
6mer
21331-21354
0.001
1
7mer
14406-14426
0.001
2
8mer
15966-15986
0.001
Not Conserved
8mer
12642-12659
0.001
1
6mer
8241-8263
0.001
2
8mer
14439-14456
0.001
1
7mer
12164-12184
0.001
Not Conserved
7mer
16246-16256
0.001
Not Conserved
7mer
11267-11287
0.001
Not Conserved
7mer
16455-16466
0.001
1
8mer
7557-7576
0.001
2
8mer
11657-11677
0.001
Not Conserved
7mer
15075-15086
0.001
Not Conserved
8mer
15459-15476
0.001
1
7mer
9833-9853
0.001
2
7mer
9803-9823
0.001
1
7mer
15426-15446
0.001
1
8mer
13119-13139
0.001
1
7mer
8280-8292
0.001
3
6mer
18908-18926
0.001
1
6mer
6586-6609
0.001
2
7mer
11327-11347
0.001
Not Conserved
7mer
9713-9730
0.001
2
6mer
20526-20535
0.001
2
6mer
9328-9355
0.001
2
6mer
9118-9142
0.001
2
6mer
23561-23586
0.000
Not Conserved
6mer
5257-5277
0.000
4
6mer
22676-22701
0.000
2
6mer
22715-22731
0.000
1
6mer
18183-18203
0.000
1
chr22-38_28785274-29006793.1
hsa-miR-145-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
240819-240838
0.025
Not Conserved
8mer
57882-57906
0.017
2
8mer
106568-106575
0.013
4
8mer
154594-154610
0.012
1
9mer
18506-18532
0.011
2
8mer
210329-210347
0.011
5
9mer
187016-187039
0.009
4
8mer
164080-164105
0.008
7
9mer
250150-250162
0.007
1
8mer
121915-121936
0.007
2
8mer
52747-52763
0.006
2
7mer
12528-12549
0.006
2
6mer
168710-168725
0.005
13
7mer
209544-209556
0.005
2
7mer
87983-88008
0.005
2
6mer
195093-195119
0.004
10
7mer
207224-207243
0.004
13
8mer
87892-87914
0.003
2
7mer
139143-139169
0.003
2
7mer
186677-186701
0.003
2
6mer
78941-78960
0.003
8
7mer
23715-23726
0.003
1
7mer
55858-55879
0.003
2
7mer
150505-150519
0.003
3
7mer
140334-140346
0.003
1
7mer
245817-245833
0.003
1
8mer
106156-106174
0.003
1
6mer
35637-35648
0.003
4
6mer
248781-248806
0.003
1
7mer
88246-88271
0.002
2
7mer
26017-26037
0.002
2
6mer
163031-163046
0.002
3
6mer
229808-229823
0.002
1
6mer
13663-13667
0.002
1
6mer
28415-28425
0.002
2
6mer
239275-239298
0.002
2
7mer
99306-99331
0.002
1
6mer
13072-13092
0.002
7
7mer
250812-250838
0.002
1
7mer
2446-2464
0.002
2
6mer
126235-126260
0.002
1
7mer
234298-234308
0.002
2
6mer
75497-75523
0.002
2
6mer
83619-83641
0.002
2
7mer
263612-263626
0.002
Not Conserved
7mer
116458-116485
0.002
2
6mer
40943-40966
0.002
1
6mer
64419-64442
0.002
2
6mer
117018-117034
0.002
1
6mer
137064-137077
0.002
1
6mer
30003-30030
0.002
3
6mer
52741-52750
0.002
1
6mer
54163-54180
0.002
2
6mer
253930-253956
0.002
2
6mer
204965-204979
0.002
1
6mer
154391-154418
0.002
3
6mer
183494-183511
0.002
4
6mer
46106-46133
0.002
2
6mer
207387-207406
0.002
4
7mer
124578-124599
0.002
1
6mer
109170-109192
0.002
2
6mer
104559-104579
0.002
1
7mer
7130-7155
0.002
2
6mer
87394-87411
0.002
1
6mer
235570-235582
0.001
2
6mer
107171-107188
0.001
Not Conserved
6mer
64736-64756
0.001
1
6mer
219695-219711
0.001
8
6mer
137433-137460
0.001
2
6mer
95890-95899
0.001
3
6mer
141679-141690
0.001
1
6mer
118382-118401
0.001
3
6mer
43573-43598
0.001
2
6mer
241789-241816
0.001
2
6mer
227011-227037
0.001
1
6mer
159622-159642
0.001
2
6mer
225924-225947
0.001
3
6mer
208981-209002
0.001
1
6mer
46622-46641
0.001
1
6mer
212405-212431
0.001
1
6mer
75551-75574
0.001
3
6mer
198298-198307
0.001
2
6mer
254209-254233
0.001
1
6mer
118108-118125
0.001
1
6mer
57995-58014
0.001
2
6mer
96431-96448
0.001
3
6mer
116599-116619
0.001
7
6mer
257173-257192
0.001
2
6mer
257065-257090
0.001
2
6mer
175422-175442
0.001
2
6mer
239416-239442
0.001
2
6mer
92197-92220
0.001
2
6mer
265360-265382
0.001
2
6mer
216110-216121
0.001
2
6mer
245635-245662
0.001
1
6mer
48940-48956
0.001
3
6mer
180865-180891
0.001
1
6mer
144231-144256
0.001
3
6mer
62673-62692
0.001
2
6mer
22104-22130
0.001
3
6mer
236138-236164
0.001
1
6mer
115945-115966
0.001
2
6mer
55425-55446
0.001
1
6mer
141413-141430
0.001
1
6mer
137144-137163
0.001
2
6mer
212485-212497
0.001
2
6mer
32932-32951
0.001
2
6mer
92252-92275
0.001
1
6mer
140453-140478
0.001
1
6mer
83668-83679
0.000
3
6mer
240618-240635
0.000
Not Conserved
KCNQ1OT1
hsa-miR-145-5p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
40279-40298
0.020
2
9mer
5283-5307
0.012
2
8mer
70071-70085
0.009
2
8mer
60483-60506
0.009
3
8mer
21227-21244
0.009
2
8mer
9046-9063
0.009
2
8mer
27956-27974
0.007
1
7mer
22998-23014
0.005
2
8mer
27050-27060
0.005
1
7mer
50647-50660
0.005
2
7mer
30665-30681
0.004
1
7mer
54216-54236
0.004
6
8mer
31754-31771
0.004
Not Conserved
6mer
51202-51212
0.003
2
6mer
12376-12388
0.003
2
6mer
48609-48632
0.002
1
6mer
43725-43736
0.002
5
6mer
63893-63903
0.002
3
7mer
83541-83553
0.002
2
6mer
40557-40569
0.002
1
6mer
39408-39434
0.002
1
6mer
10875-10879
0.002
2
7mer
84732-84758
0.002
1
6mer
58514-58523
0.002
4
6mer
36679-36704
0.002
1
6mer
71395-71409
0.002
2
6mer
32854-32874
0.002
1
6mer
68033-68050
0.002
2
6mer
39674-39695
0.001
1
6mer
50870-50893
0.001
2
6mer
84269-84292
0.001
2
6mer
21621-21637
0.001
2
7mer
6275-6292
0.001
2
6mer
83375-83393
0.001
2
6mer
84869-84893
0.001
1
6mer
55767-55791
0.001
1
6mer
64425-64448
0.001
2
6mer
83747-83769
0.001
2
6mer
76054-76073
0.001
4
6mer
43251-43275
0.001
2
6mer
52516-52527
0.001
1
6mer
70896-70921
0.001
2
6mer
90386-90409
0.001
2
6mer
37089-37104
0.001
1
6mer
55733-55753
0.000
2
AC003973.4
hsa-miR-145-5p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000596778
Biotype: lincRNA
Gene id: ENSG00000269504
Gene Name: AC003973.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
102-122
0.072
1
7mer
1026-1049
0.022
1
6mer
1292-1316
0.020
1
6mer
51-73
0.018
1
6mer
901-924
0.009
1
RP11-32B5.8
hsa-miR-145-5p
0.999

Gene Details
Chromosome: 15
Transcript: ENST00000594169
Biotype: lincRNA
Gene id: ENSG00000268531
Gene Name: RP11-32B5.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
180-193
0.009
2
6mer
130-155
0.009
2
6mer
80-106
0.009
2
6mer
1928-1950
0.009
2
6mer
237-258
0.008
2
7mer
1380-1399
0.007
2
6mer
1621-1646
0.006
2
6mer
1806-1832
0.006
2
6mer
1696-1722
0.006
2
6mer
1660-1685
0.005
2
6mer
645-670
0.005
2
6mer
1867-1884
0.004
1
6mer
568-595
0.004
2
6mer
17-39
0.004
1
6mer
1451-1476
0.004
2
6mer
498-518
0.004
1
6mer
467-492
0.003
1
6mer
1288-1313
0.003
1
6mer
606-631
0.003
2
7mer
855-881
0.003
1
6mer
1982-1996
0.003
1
6mer
752-776
0.003
1
6mer
1102-1114
0.002
1
6mer
790-816
0.002
1
6mer
774-788
0.002
2
6mer
1505-1530
0.002
1
6mer
972-998
0.002
1
6mer
1581-1607
0.001
Not Conserved
6mer
1346-1364
0.001
Not Conserved
LINC01002
hsa-miR-145-5p
0.999

Gene Details
Chromosome: 19
Transcript: ENST00000618269
Biotype: lincRNA
Gene id: ENSG00000206082
Gene Name: LINC01002
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
92-107
0.107
2
6mer
241-267
0.013
2
LINC01347
hsa-miR-145-5p
0.999

Gene Details
Chromosome: 1
Transcript: ENST00000415989
Biotype: retained_intron
Gene id: ENSG00000214837
Gene Name: LINC01347
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
126-141
0.111
2
6mer
276-292
0.008
1
RP11-340I6.7
hsa-miR-145-5p
0.999

Gene Details
Chromosome: 7
Transcript: ENST00000600182
Biotype: lincRNA
Gene id: ENSG00000236299
Gene Name: RP11-340I6.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
604-628
0.096
1
6mer
88-92
0.022
1
LINC01347
hsa-miR-145-5p
0.998

Gene Details
Chromosome: 1
Transcript: ENST00000431528
Biotype: retained_intron
Gene id: ENSG00000214837
Gene Name: LINC01347
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
51-66
0.115
2
XLOC_000782
hsa-miR-145-5p
0.998

Gene Details
Chromosome: chr1
Transcript: TCONS_00001452
Biotype: transcript isomorph
Gene id: XLOC_000782
Gene Name: XLOC_000782
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1959-1971
0.084
1
6mer
2271-2298
0.015
1
6mer
1750-1762
0.013
1
LINC00948
hsa-miR-145-5p
0.997

Gene Details
Chromosome: 10
Transcript: ENST00000430431
Biotype: lincRNA
Gene id: ENSG00000227877
Gene Name: LINC00948
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
188-210
0.099
7
6mer
455-479
0.004
1
LINC00661
hsa-miR-145-5p
0.996

Gene Details
Chromosome: 19
Transcript: ENST00000552685
Biotype: lincRNA
Gene id: ENSG00000205396
Gene Name: LINC00661
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
507-527
0.102
2
LINC00948
hsa-miR-145-5p
0.996

Gene Details
Chromosome: 10
Transcript: ENST00000414264
Biotype: lincRNA
Gene id: ENSG00000227877
Gene Name: LINC00948
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
188-210
0.097
7
6mer
333-357
0.004
1
CTA-390C10.9
hsa-miR-145-5p
0.996

Gene Details
Chromosome: 22
Transcript: ENST00000609964
Biotype: lincRNA
Gene id: ENSG00000272798
Gene Name: CTA-390C10.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
588-594
0.063
1
7mer
408-431
0.012
1
6mer
94-121
0.008
1
7mer
232-255
0.006
Not Conserved
7mer
349-372
0.006
Not Conserved
7mer
290-313
0.006
Not Conserved
LINC00948
hsa-miR-145-5p
0.996

Gene Details
Chromosome: 10
Transcript: ENST00000594536
Biotype: lincRNA
Gene id: ENSG00000227877
Gene Name: LINC00948
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
188-210
0.096
7
6mer
431-455
0.004
1
RP11-586K12.11
hsa-miR-145-5p
0.994

Gene Details
Chromosome: 16
Transcript: ENST00000565347
Biotype: lincRNA
Gene id: ENSG00000261569
Gene Name: RP11-586K12.11
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
370-383
0.093
1
6mer
133-145
0.002
Not Conserved
RP11-1437A8.6
hsa-miR-145-5p
0.994

Gene Details
Chromosome: 16
Transcript: ENST00000569199
Biotype: lincRNA
Gene id: ENSG00000261507
Gene Name: RP11-1437A8.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
158-171
0.093
1
6mer
396-408
0.002
Not Conserved
CTD-2263F21.1
hsa-miR-145-5p
0.992

Gene Details
Chromosome: 5
Transcript: ENST00000510469
Biotype: antisense
Gene id: ENSG00000251257
Gene Name: CTD-2263F21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
14-40
0.078
2
7mer
32-43
0.011
1
RP1-20N2.8
hsa-miR-145-5p
0.989

Gene Details
Chromosome: 6
Transcript: ENST00000591892
Biotype: processed_transcript
Gene id: ENSG00000278206
Gene Name: RP1-20N2.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
290-311
0.046
2
8mer
487-513
0.030
6
7mer
520-540
0.006
3
6mer
1337-1356
0.003
3
LINC00664
hsa-miR-145-5p
0.989

Gene Details
Chromosome: 19
Transcript: ENST00000596203
Biotype: lincRNA
Gene id: ENSG00000268658
Gene Name: LINC00664
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-145-5p
Sequence: guccaguuuucccaggaaucccu
MirBase ID: MIMAT0000437
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
87-111
0.030
2
7mer
310-333
0.023
2
6mer
419-434
0.018
2
6mer
63-74
0.012
1
6mer
447-471
0.002
Not Conserved
Funded by: