Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-183-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-183-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
266940-266957
0.021
2
7mer
266790-266795
0.013
2
8mer
41908-41928
0.009
1
8mer
231934-231940
0.008
Not Conserved
8mer
53649-53672
0.008
2
7mer
261716-261739
0.006
2
7mer
18755-18769
0.005
1
8mer
48413-48432
0.005
1
7mer
80849-80869
0.005
4
7mer
101995-102009
0.005
2
7mer
96003-96027
0.004
2
7mer
70122-70145
0.004
1
8mer
3104-3121
0.004
1
7mer
19367-19386
0.004
2
7mer
264340-264362
0.004
1
7mer
55884-55895
0.004
2
7mer
41146-41163
0.004
1
6mer
149698-149719
0.004
9
8mer
4855-4868
0.003
1
7mer
151062-151088
0.003
1
8mer
41933-41944
0.003
3
9mer
248804-248827
0.003
1
6mer
91180-91184
0.003
5
7mer
211112-211137
0.003
3
6mer
22342-22368
0.003
8
6mer
266974-266993
0.003
2
7mer
177527-177538
0.003
2
6mer
17605-17610
0.003
2
6mer
173518-173535
0.003
4
6mer
196387-196411
0.003
4
7mer
258395-258415
0.003
2
6mer
226570-226591
0.003
2
6mer
39963-39974
0.002
2
6mer
235035-235055
0.002
Not Conserved
6mer
224-241
0.002
1
6mer
254304-254320
0.002
3
6mer
188967-188986
0.002
1
6mer
205705-205722
0.002
1
6mer
11087-11102
0.002
4
6mer
31932-31941
0.002
4
6mer
230708-230713
0.002
1
6mer
60569-60579
0.002
3
6mer
195295-195318
0.002
3
6mer
182818-182839
0.002
2
6mer
151997-152002
0.002
2
6mer
256268-256280
0.002
1
6mer
107240-107253
0.002
1
6mer
131404-131412
0.002
2
6mer
141858-141879
0.002
2
6mer
35670-35692
0.002
3
6mer
84416-84433
0.002
3
6mer
41015-41022
0.002
3
6mer
154494-154510
0.002
2
6mer
72799-72823
0.002
5
6mer
50683-50702
0.002
3
6mer
57294-57315
0.002
3
7mer
176964-176979
0.002
1
6mer
249124-249140
0.002
1
6mer
231605-231617
0.002
1
6mer
79635-79657
0.002
2
6mer
151252-151275
0.002
2
6mer
26791-26804
0.002
2
6mer
175572-175595
0.002
2
6mer
153647-153651
0.002
2
6mer
113873-113896
0.002
3
6mer
55610-55633
0.002
1
6mer
232777-232785
0.002
2
6mer
134145-134158
0.002
3
6mer
86561-86587
0.002
2
7mer
254325-254337
0.002
4
6mer
184876-184888
0.002
2
6mer
208905-208932
0.002
2
6mer
10372-10388
0.002
2
6mer
57433-57457
0.002
2
6mer
148097-148113
0.002
4
6mer
98299-98325
0.002
1
6mer
42311-42326
0.002
2
6mer
59334-59347
0.002
2
6mer
28033-28049
0.002
3
6mer
97569-97574
0.002
2
6mer
260976-261003
0.001
2
6mer
233775-233784
0.001
2
6mer
53940-53959
0.001
2
6mer
251937-251957
0.001
1
6mer
201028-201051
0.001
1
6mer
33105-33127
0.001
3
6mer
182003-182028
0.001
2
7mer
53784-53799
0.001
2
6mer
248679-248706
0.001
Not Conserved
7mer
53948-53970
0.001
2
6mer
29228-29252
0.001
3
6mer
171294-171321
0.001
2
7mer
41945-41965
0.001
2
6mer
153323-153346
0.001
2
6mer
203874-203901
0.001
2
6mer
220470-220489
0.001
2
6mer
220621-220646
0.001
2
6mer
258890-258903
0.001
3
6mer
44137-44145
0.001
Not Conserved
6mer
258348-258358
0.001
2
6mer
11148-11159
0.001
2
6mer
78428-78446
0.001
2
6mer
152367-152378
0.001
2
6mer
102561-102586
0.001
3
6mer
188504-188521
0.001
1
6mer
24292-24316
0.001
2
6mer
236825-236850
0.001
2
6mer
241595-241619
0.001
2
6mer
203926-203931
0.001
2
6mer
89024-89042
0.001
2
6mer
196438-196461
0.001
3
XLOC_004700
hsa-miR-183-3p
1.000

Gene Details
Chromosome: chr5
Transcript: TCONS_00010232
Biotype: transcript isomorph
Gene id: XLOC_004700
Gene Name: XLOC_004700
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
761-784
0.007
Not Conserved
6mer
384-398
0.006
1
8mer
407-416
0.006
Not Conserved
6mer
6894-6905
0.004
Not Conserved
6mer
6830-6839
0.004
Not Conserved
6mer
6778-6801
0.004
Not Conserved
6mer
6745-6752
0.004
Not Conserved
6mer
6810-6821
0.004
Not Conserved
6mer
6876-6887
0.004
Not Conserved
6mer
6757-6772
0.004
Not Conserved
6mer
6665-6672
0.004
Not Conserved
6mer
6518-6529
0.004
Not Conserved
6mer
6633-6656
0.003
Not Conserved
6mer
6695-6704
0.003
Not Conserved
6mer
6709-6719
0.003
Not Conserved
6mer
6474-6485
0.003
Not Conserved
6mer
6538-6549
0.003
Not Conserved
6mer
6582-6592
0.003
Not Conserved
6mer
6402-6413
0.003
Not Conserved
6mer
6353-6360
0.003
Not Conserved
6mer
6494-6509
0.003
Not Conserved
6mer
6390-6409
0.003
Not Conserved
6mer
6558-6573
0.003
Not Conserved
6mer
6450-6465
0.003
Not Conserved
6mer
580-594
0.003
Not Conserved
6mer
6313-6324
0.002
Not Conserved
6mer
564-579
0.002
Not Conserved
6mer
6293-6304
0.002
Not Conserved
6mer
706-720
0.002
Not Conserved
6mer
6273-6284
0.002
Not Conserved
6mer
6157-6168
0.002
Not Conserved
6mer
6181-6188
0.002
Not Conserved
6mer
6253-6264
0.002
Not Conserved
6mer
6201-6212
0.002
Not Conserved
6mer
5943-5954
0.002
Not Conserved
6mer
833-844
0.002
Not Conserved
6mer
6137-6148
0.002
Not Conserved
6mer
6041-6053
0.002
Not Conserved
6mer
853-864
0.002
Not Conserved
6mer
721-738
0.002
Not Conserved
6mer
6065-6076
0.002
Not Conserved
6mer
5899-5910
0.001
Not Conserved
6mer
679-690
0.001
Not Conserved
6mer
6023-6030
0.001
Not Conserved
6mer
6085-6096
0.001
Not Conserved
6mer
6007-6030
0.001
Not Conserved
6mer
889-912
0.001
Not Conserved
6mer
3584-3591
0.001
Not Conserved
6mer
953-971
0.001
Not Conserved
6mer
985-1004
0.001
Not Conserved
6mer
5844-5866
0.001
Not Conserved
6mer
919-942
0.001
Not Conserved
6mer
2953-2960
0.001
Not Conserved
6mer
1049-1072
0.001
Not Conserved
6mer
1109-1134
0.001
Not Conserved
6mer
5780-5803
0.001
Not Conserved
6mer
5796-5807
0.001
Not Conserved
6mer
5923-5934
0.001
Not Conserved
6mer
5983-5998
0.001
Not Conserved
6mer
1029-1038
0.001
Not Conserved
6mer
1077-1100
0.001
Not Conserved
6mer
1013-1022
0.001
Not Conserved
6mer
945-960
0.001
Not Conserved
6mer
5740-5763
0.001
Not Conserved
6mer
1149-1160
0.001
Not Conserved
6mer
1253-1260
0.001
Not Conserved
6mer
1200-1211
0.001
Not Conserved
6mer
1375-1386
0.001
Not Conserved
6mer
1241-1260
0.001
Not Conserved
6mer
1169-1180
0.001
Not Conserved
6mer
3970-3981
0.001
Not Conserved
6mer
5626-5651
0.001
Not Conserved
6mer
5756-5771
0.001
Not Conserved
6mer
2685-2692
0.001
Not Conserved
6mer
1185-1192
0.001
Not Conserved
6mer
1919-1930
0.001
Not Conserved
6mer
1291-1302
0.001
Not Conserved
6mer
1479-1500
0.001
Not Conserved
7mer
1467-1474
0.001
Not Conserved
6mer
4370-4381
0.001
Not Conserved
6mer
1331-1338
0.001
Not Conserved
6mer
1995-2006
0.001
Not Conserved
6mer
1639-1650
0.001
Not Conserved
6mer
2399-2410
0.001
Not Conserved
6mer
5680-5691
0.001
Not Conserved
6mer
5700-5725
0.001
Not Conserved
6mer
3798-3809
0.001
Not Conserved
6mer
5582-5593
0.001
Not Conserved
6mer
4498-4509
0.001
Not Conserved
6mer
5448-5455
0.001
Not Conserved
6mer
2633-2656
0.001
Not Conserved
6mer
4185-4196
0.001
Not Conserved
6mer
5508-5519
0.001
Not Conserved
6mer
5660-5671
0.001
Not Conserved
6mer
5528-5543
0.001
Not Conserved
6mer
1363-1370
0.001
Not Conserved
6mer
5060-5071
0.001
Not Conserved
6mer
4641-4648
0.001
Not Conserved
6mer
1791-1802
0.001
Not Conserved
6mer
2871-2882
0.001
Not Conserved
6mer
4940-4950
0.001
Not Conserved
6mer
2195-2210
0.001
Not Conserved
6mer
3209-3232
0.001
Not Conserved
6mer
2559-2570
0.001
Not Conserved
6mer
3261-3272
0.001
Not Conserved
6mer
4354-4377
0.001
Not Conserved
6mer
1587-1594
0.001
Not Conserved
6mer
4870-4881
0.001
Not Conserved
6mer
3564-3575
0.001
Not Conserved
6mer
4458-4469
0.001
Not Conserved
6mer
1855-1866
0.001
Not Conserved
6mer
5108-5119
0.001
Not Conserved
6mer
4283-4294
0.001
Not Conserved
6mer
5330-5341
0.001
Not Conserved
6mer
2511-2522
0.001
Not Conserved
6mer
4759-4770
0.001
Not Conserved
6mer
4584-4596
0.001
Not Conserved
6mer
1603-1618
0.001
Not Conserved
6mer
2143-2154
0.001
Not Conserved
6mer
2447-2458
0.001
Not Conserved
6mer
3906-3917
0.001
Not Conserved
6mer
3141-3164
0.001
Not Conserved
6mer
5190-5201
0.001
Not Conserved
6mer
3400-3411
0.001
Not Conserved
6mer
4803-4815
0.001
Not Conserved
6mer
4856-4881
0.001
Not Conserved
6mer
2237-2248
0.001
Not Conserved
6mer
3380-3391
0.001
Not Conserved
6mer
2915-2926
0.001
Not Conserved
6mer
4141-4152
0.001
Not Conserved
6mer
4161-4172
0.001
Not Conserved
6mer
2595-2606
0.001
Not Conserved
6mer
5008-5017
0.001
Not Conserved
6mer
3177-3184
0.001
Not Conserved
6mer
4086-4108
0.001
Not Conserved
6mer
1459-1466
0.001
Not Conserved
6mer
3325-3347
0.001
Not Conserved
6mer
4685-4692
0.001
Not Conserved
6mer
5308-5319
0.001
Not Conserved
6mer
2819-2830
0.001
Not Conserved
6mer
2056-2067
0.001
Not Conserved
6mer
2088-2099
0.001
Not Conserved
6mer
3760-3771
0.001
Not Conserved
6mer
1757-1782
0.001
Not Conserved
6mer
2771-2783
0.001
Not Conserved
6mer
2575-2586
0.001
Not Conserved
6mer
1567-1574
0.001
Not Conserved
6mer
1815-1822
0.001
Not Conserved
6mer
5158-5181
0.001
Not Conserved
6mer
3524-3535
0.001
Not Conserved
6mer
2891-2906
0.001
Not Conserved
6mer
3926-3933
0.001
Not Conserved
6mer
2835-2846
0.001
Not Conserved
6mer
3077-3088
0.001
Not Conserved
6mer
5716-5731
0.001
Not Conserved
6mer
2309-2316
0.001
Not Conserved
6mer
2375-2387
0.001
Not Conserved
6mer
2435-2458
0.001
Not Conserved
6mer
2347-2358
0.001
Not Conserved
6mer
4344-4361
0.001
Not Conserved
6mer
5428-5439
0.001
Not Conserved
6mer
4564-4575
0.001
Not Conserved
6mer
4988-4999
0.001
Not Conserved
6mer
3468-3479
0.001
Not Conserved
6mer
3946-3957
0.001
Not Conserved
6mer
4538-4550
0.001
Not Conserved
6mer
3740-3751
0.001
Not Conserved
6mer
5390-5399
0.001
Not Conserved
6mer
2279-2302
0.001
Not Conserved
6mer
1903-1926
0.001
Not Conserved
6mer
1879-1894
0.001
Not Conserved
6mer
3492-3516
0.001
Not Conserved
6mer
1269-1284
0.001
Not Conserved
6mer
3444-3457
0.001
Not Conserved
6mer
1717-1728
0.001
Not Conserved
6mer
5366-5377
0.001
Not Conserved
6mer
4121-4132
0.001
Not Conserved
6mer
3360-3371
0.001
Not Conserved
6mer
3886-3897
0.001
Not Conserved
6mer
4783-4794
0.001
Not Conserved
6mer
2329-2340
0.001
Not Conserved
6mer
4261-4272
0.001
Not Conserved
6mer
4705-4724
0.001
Not Conserved
6mer
5292-5303
0.001
Not Conserved
6mer
4303-4314
0.001
Not Conserved
6mer
3245-3256
0.001
Not Conserved
6mer
1831-1846
0.001
Not Conserved
6mer
4916-4928
0.001
Not Conserved
6mer
1627-1646
0.001
Not Conserved
6mer
5268-5280
0.001
Not Conserved
6mer
1733-1744
0.001
Not Conserved
6mer
2487-2499
0.001
Not Conserved
6mer
2112-2123
0.001
Not Conserved
6mer
4727-4750
0.001
Not Conserved
6mer
2539-2550
0.001
Not Conserved
6mer
5230-5240
0.001
Not Conserved
6mer
3193-3202
0.001
Not Conserved
6mer
4323-4335
0.001
Not Conserved
6mer
3862-3877
0.001
Not Conserved
6mer
3101-3113
0.001
Not Conserved
6mer
3117-3132
0.001
Not Conserved
6mer
3504-3516
0.001
Not Conserved
6mer
2187-2202
0.001
Not Conserved
6mer
2128-2138
0.001
Not Conserved
KCNQ1OT1
hsa-miR-183-3p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
89334-89346
0.008
3
7mer
52876-52895
0.006
1
7mer
937-953
0.006
2
7mer
27017-27036
0.006
1
7mer
21809-21824
0.005
2
6mer
66012-66038
0.005
8
7mer
22839-22854
0.005
1
7mer
18597-18612
0.004
1
7mer
7765-7777
0.004
2
7mer
23926-23931
0.004
2
7mer
29875-29888
0.004
1
6mer
86738-86764
0.004
3
7mer
22345-22363
0.004
2
6mer
66310-66323
0.003
5
7mer
89963-89985
0.003
2
6mer
74137-74155
0.003
5
6mer
24934-24954
0.003
2
6mer
58224-58248
0.003
6
7mer
7612-7631
0.003
Not Conserved
6mer
38865-38880
0.003
1
6mer
89516-89527
0.003
5
6mer
51448-51452
0.003
2
7mer
7297-7313
0.003
1
6mer
63884-63903
0.002
2
6mer
36204-36222
0.002
1
6mer
38533-38546
0.002
1
6mer
15769-15781
0.002
2
6mer
6345-6357
0.002
2
6mer
35760-35778
0.002
1
6mer
41856-41871
0.002
2
6mer
23333-23351
0.002
2
6mer
10191-10206
0.002
2
6mer
36910-36925
0.002
1
6mer
29584-29602
0.002
1
6mer
48557-48567
0.002
2
6mer
41151-41170
0.002
2
7mer
37526-37547
0.002
1
6mer
43185-43201
0.002
2
6mer
27622-27648
0.002
1
6mer
70609-70629
0.002
2
6mer
33797-33823
0.002
1
6mer
8353-8371
0.002
2
6mer
71506-71525
0.002
2
6mer
47520-47532
0.002
2
6mer
26524-26543
0.002
Not Conserved
6mer
40600-40611
0.002
2
6mer
4792-4816
0.002
2
6mer
1317-1324
0.002
1
6mer
1418-1436
0.002
1
6mer
37811-37834
0.002
1
6mer
60164-60187
0.002
2
6mer
64251-64271
0.002
2
6mer
45954-45970
0.001
2
6mer
52439-52459
0.001
2
6mer
7445-7453
0.001
2
6mer
40452-40470
0.001
1
6mer
28076-28092
0.001
1
6mer
23006-23016
0.001
1
6mer
30377-30393
0.001
1
6mer
28472-28487
0.001
Not Conserved
6mer
32179-32193
0.001
1
6mer
24925-24940
0.001
2
6mer
66234-66249
0.001
2
6mer
30305-30316
0.001
1
6mer
23888-23913
0.001
1
6mer
52867-52887
0.001
2
6mer
6320-6334
0.001
1
RP11-212D3.4
hsa-miR-183-3p
0.996

Gene Details
Chromosome: X
Transcript: ENST00000413763
Biotype: lincRNA
Gene id: ENSG00000226854
Gene Name: RP11-212D3.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
135-155
0.064
1
6mer
81-105
0.021
1
6mer
668-694
0.017
1
XLOC_001612
hsa-miR-183-3p
0.996

Gene Details
Chromosome: chr2
Transcript: TCONS_00002651
Biotype: transcript isomorph
Gene id: XLOC_001612
Gene Name: XLOC_001612
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
680-692
0.075
1
7mer
80-96
0.025
1
XLOC_008328
hsa-miR-183-3p
0.995

Gene Details
Chromosome: chrY
Transcript: TCONS_00017652
Biotype: transcript isomorph
Gene id: XLOC_008328
Gene Name: XLOC_008328
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Heart Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1284-1297
0.073
1
6mer
1368-1379
0.023
1
RP11-309H21.3
hsa-miR-183-3p
0.993

Gene Details
Chromosome: 1
Transcript: ENST00000563320
Biotype: lincRNA
Gene id: ENSG00000261642
Gene Name: RP11-309H21.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2637-2659
0.053
1
7mer
987-1004
0.018
1
7mer
2365-2386
0.015
1
6mer
1690-1713
0.006
1
PRKG1-AS1
hsa-miR-183-3p
0.993

Gene Details
Chromosome: 10
Transcript: NR_038277.1
Biotype: antisense
Gene id: NR_038277.1 (gene)
Gene Name: PRKG1-AS1
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
664-676
0.029
11
7mer
402-416
0.020
9
9mer
78-101
0.018
5
8mer
1953-1966
0.016
4
6mer
113-130
0.010
6
RP3-323A16.1
hsa-miR-183-3p
0.991

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
24706-24726
0.007
2
7mer
15411-15426
0.005
2
7mer
27014-27027
0.005
2
7mer
20077-20093
0.005
Not Conserved
6mer
53402-53420
0.004
2
7mer
549-568
0.004
1
7mer
6830-6847
0.003
1
7mer
46804-46826
0.003
2
7mer
32207-32229
0.003
1
7mer
26583-26605
0.003
2
6mer
19505-19530
0.003
3
7mer
29928-29948
0.003
Not Conserved
6mer
22929-22942
0.003
3
6mer
48834-48855
0.002
2
6mer
1707-1718
0.002
2
6mer
48520-48545
0.002
2
6mer
26058-26074
0.002
2
6mer
46540-46547
0.002
2
6mer
25588-25607
0.002
1
6mer
44087-44107
0.002
2
7mer
26655-26664
0.002
2
6mer
6069-6084
0.002
1
6mer
49213-49229
0.002
2
6mer
2544-2557
0.002
2
6mer
25260-25276
0.001
2
6mer
24819-24823
0.001
2
6mer
13395-13409
0.001
2
6mer
6326-6342
0.001
1
6mer
26730-26734
0.001
2
6mer
8632-8648
0.001
1
6mer
12269-12283
0.001
1
6mer
8243-8258
0.001
Not Conserved
6mer
48621-48637
0.001
1
6mer
46551-46575
0.001
2
6mer
6403-6414
0.001
1
6mer
19521-19536
0.001
3
XLOC_008602
hsa-miR-183-3p
0.991

Gene Details
Chromosome: chr10
Transcript: TCONS_00018322
Biotype: transcript isomorph
Gene id: XLOC_008602
Gene Name: XLOC_008602
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
528-543
0.031
2
6mer
587-600
0.031
2
7mer
360-384
0.025
1
AC006548.28
hsa-miR-183-3p
0.988

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
34460-34471
0.006
1
8mer
40802-40817
0.006
1
7mer
21127-21140
0.006
1
7mer
47723-47746
0.006
Not Conserved
8mer
81718-81724
0.004
1
7mer
20302-20317
0.004
1
7mer
64719-64734
0.004
1
7mer
67495-67506
0.003
Not Conserved
7mer
60301-60317
0.003
1
7mer
82939-82960
0.003
2
7mer
57231-57255
0.003
1
7mer
50577-50594
0.003
Not Conserved
6mer
19946-19970
0.003
7
6mer
73917-73934
0.003
2
6mer
67909-67935
0.002
1
6mer
51089-51099
0.002
Not Conserved
6mer
50285-50303
0.002
Not Conserved
6mer
48326-48352
0.002
Not Conserved
6mer
81301-81319
0.002
2
6mer
49169-49184
0.002
Not Conserved
6mer
73144-73163
0.002
2
7mer
6956-6967
0.002
2
6mer
38086-38108
0.001
2
6mer
82254-82275
0.001
2
6mer
65889-65913
0.001
Not Conserved
6mer
6998-7019
0.001
2
6mer
6118-6137
0.001
2
6mer
48773-48789
0.001
Not Conserved
6mer
62783-62805
0.001
2
6mer
67833-67846
0.001
1
6mer
44942-44956
0.001
1
6mer
51011-51022
0.001
Not Conserved
6mer
51083-51099
0.000
Not Conserved
XLOC_003873
hsa-miR-183-3p
0.987

Gene Details
Chromosome: chr4
Transcript: TCONS_00008418
Biotype: transcript isomorph
Gene id: XLOC_003873
Gene Name: XLOC_003873
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
253-261
0.029
1
6mer
134-142
0.027
1
6mer
217-233
0.026
1
LINC01347
hsa-miR-183-3p
0.985

Gene Details
Chromosome: 1
Transcript: ENST00000435793
Biotype: retained_intron
Gene id: ENSG00000214837
Gene Name: LINC01347
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
48-62
0.072
2
6mer
634-649
0.007
1
AC004540.4
hsa-miR-183-3p
0.983

Gene Details
Chromosome: 7
Transcript: ENST00000451368
Biotype: antisense
Gene id: ENSG00000225792
Gene Name: AC004540.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
155-164
0.050
13
7mer
86-99
0.027
12
RP11-890B15.2
hsa-miR-183-3p
0.982

Gene Details
Chromosome: 11
Transcript: ENST00000533812
Biotype: lincRNA
Gene id: ENSG00000254842
Gene Name: RP11-890B15.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
13-36
0.070
9
7mer
1276-1293
0.006
2
XLOC_009546
hsa-miR-183-3p
0.980

Gene Details
Chromosome: chr11
Transcript: TCONS_00019752
Biotype: transcript isomorph
Gene id: XLOC_009546
Gene Name: XLOC_009546
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
132-156
0.075
2
LINC00920
hsa-miR-183-3p
0.980

Gene Details
Chromosome: 16
Transcript: ENST00000499966
Biotype: lincRNA
Gene id: ENSG00000246898
Gene Name: LINC00920
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2015-2020
0.021
1
7mer
2125-2146
0.016
1
7mer
1886-1911
0.014
1
7mer
967-992
0.008
2
6mer
1716-1728
0.006
2
6mer
1643-1659
0.006
1
6mer
375-394
0.005
2
XLOC_000371
hsa-miR-183-3p
0.978

Gene Details
Chromosome: chr1
Transcript: TCONS_00001130
Biotype: transcript isomorph
Gene id: XLOC_000371
Gene Name: XLOC_000371
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
249-275
0.073
2
XLOC_011755
hsa-miR-183-3p
0.978

Gene Details
Chromosome: chr16
Transcript: TCONS_00024251
Biotype: transcript isomorph
Gene id: XLOC_011755
Gene Name: XLOC_011755
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2060-2065
0.021
1
7mer
2170-2191
0.016
1
7mer
1931-1956
0.014
1
7mer
1012-1037
0.007
2
6mer
1761-1773
0.005
2
6mer
420-439
0.005
2
6mer
1688-1704
0.004
1
XLOC_001668
hsa-miR-183-3p
0.974

Gene Details
Chromosome: chr2
Transcript: TCONS_00003870
Biotype: transcript isomorph
Gene id: XLOC_001668
Gene Name: XLOC_001668
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-183-3p
Sequence: gugaauuaccgaagggccauaa
MirBase ID: MIMAT0004560
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1807-1818
0.034
2
6mer
599-612
0.016
2
6mer
1479-1494
0.006
2
6mer
917-944
0.005
2
6mer
4151-4155
0.004
1
6mer
917-928
0.004
1
Funded by: