Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_011484
hsa-miR-1910-5p
1.000

Gene Details
Chromosome: chr15
Transcript: TCONS_00023685
Biotype: transcript isomorph
Gene id: XLOC_011484
Gene Name: XLOC_011484
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3169-3187
0.063
1
8mer
1591-1609
0.025
1
7mer
2839-2851
0.022
1
9mer
2105-2126
0.021
1
7mer
2316-2332
0.016
1
6mer
2946-2972
0.014
1
6mer
2583-2594
0.008
1
6mer
3318-3329
0.003
Not Conserved
chr22-38_28785274-29006793.1
hsa-miR-1910-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
235527-235546
0.009
3
8mer
92197-92219
0.008
2
9mer
95887-95898
0.006
3
7mer
16307-16326
0.006
2
8mer
168778-168791
0.005
2
7mer
248766-248785
0.004
1
7mer
163481-163496
0.004
7
7mer
40878-40903
0.004
2
7mer
196049-196071
0.003
2
9mer
237778-237802
0.003
2
7mer
21621-21640
0.003
2
6mer
226818-226836
0.003
5
7mer
160742-160757
0.003
4
8mer
93178-93204
0.003
3
7mer
32933-32950
0.003
2
6mer
179813-179821
0.002
5
8mer
259231-259247
0.002
2
8mer
43255-43275
0.002
2
7mer
33582-33607
0.002
3
6mer
130571-130591
0.002
4
6mer
179460-179470
0.002
2
7mer
72049-72066
0.002
Not Conserved
6mer
75495-75522
0.002
2
7mer
7133-7153
0.002
2
9mer
94526-94548
0.002
2
6mer
57994-58012
0.002
2
6mer
172399-172419
0.002
1
7mer
62674-62691
0.002
2
7mer
117969-117977
0.002
2
6mer
43573-43597
0.002
4
6mer
120482-120493
0.002
5
7mer
93272-93284
0.002
4
6mer
47335-47346
0.002
2
6mer
128942-128950
0.002
3
6mer
67058-67084
0.002
2
6mer
21137-21162
0.001
1
6mer
149891-149913
0.001
7
6mer
88764-88780
0.001
1
6mer
111760-111769
0.001
1
6mer
80140-80166
0.001
1
6mer
68788-68801
0.001
2
6mer
189235-189255
0.001
2
7mer
16528-16553
0.001
2
7mer
81197-81216
0.001
5
6mer
35934-35943
0.001
3
6mer
204465-204489
0.001
2
6mer
23966-23992
0.001
2
7mer
241900-241923
0.001
1
6mer
239458-239476
0.001
2
6mer
200113-200136
0.001
2
6mer
46214-46222
0.001
2
6mer
79119-79133
0.001
2
6mer
204070-204096
0.001
Not Conserved
6mer
236063-236075
0.001
Not Conserved
6mer
218551-218576
0.001
1
6mer
169469-169489
0.001
1
6mer
12127-12136
0.001
1
6mer
124570-124597
0.001
1
6mer
57136-57146
0.001
2
6mer
74773-74787
0.001
2
6mer
184495-184510
0.001
1
6mer
220027-220048
0.001
1
6mer
30008-30032
0.001
3
6mer
30330-30347
0.001
2
7mer
239510-239529
0.001
1
8mer
214194-214213
0.001
2
6mer
182750-182777
0.001
2
6mer
205363-205372
0.001
1
6mer
205998-206022
0.001
Not Conserved
6mer
125378-125396
0.001
1
6mer
252082-252103
0.001
1
6mer
120502-120517
0.000
3
XLOC_006349
hsa-miR-1910-5p
0.998

Gene Details
Chromosome: chr7
Transcript: TCONS_00013687
Biotype: transcript isomorph
Gene id: XLOC_006349
Gene Name: XLOC_006349
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
- Breast Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
388-405
0.078
1
6mer
58-70
0.017
1
6mer
165-191
0.014
1
XLOC_004915
hsa-miR-1910-5p
0.994

Gene Details
Chromosome: chr5
Transcript: TCONS_00010981
Biotype: transcript isomorph
Gene id: XLOC_004915
Gene Name: XLOC_004915
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
382-408
0.078
1
6mer
162-188
0.014
1
6mer
474-500
0.003
Not Conserved
RP11-285E9.6
hsa-miR-1910-5p
0.989

Gene Details
Chromosome: 17
Transcript: ENST00000582422
Biotype: lincRNA
Gene id: ENSG00000263718
Gene Name: RP11-285E9.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
167-183
0.084
2
XLOC_003701
hsa-miR-1910-5p
0.987

Gene Details
Chromosome: chr4
Transcript: TCONS_00008259
Biotype: transcript isomorph
Gene id: XLOC_003701
Gene Name: XLOC_003701
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
142-168
0.081
1
KB-1592A4.14
hsa-miR-1910-5p
0.983

Gene Details
Chromosome: 22
Transcript: ENST00000417463
Biotype: lincRNA
Gene id: ENSG00000234503
Gene Name: KB-1592A4.14
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
345-361
0.077
2
XLOC_013499
hsa-miR-1910-5p
0.982

Gene Details
Chromosome: chr20
Transcript: TCONS_00028139
Biotype: transcript isomorph
Gene id: XLOC_013499
Gene Name: XLOC_013499
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
107-133
0.076
1
LOC100506639
hsa-miR-1910-5p
0.982

Gene Details
Chromosome: 5
Transcript: NR_102752.1
Biotype: sense
Gene id: NR_102752.1 (gene)
Gene Name: LOC100506639
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1035-1058
0.070
2
6mer
154-176
0.006
1
AC093642.3
hsa-miR-1910-5p
0.981

Gene Details
Chromosome: 2
Transcript: ENST00000451070
Biotype: retained_intron
Gene id: ENSG00000237940
Gene Name: AC093642.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
70-83
0.075
1
RP11-285E9.5
hsa-miR-1910-5p
0.980

Gene Details
Chromosome: 17
Transcript: ENST00000584075
Biotype: lincRNA
Gene id: ENSG00000265121
Gene Name: RP11-285E9.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
109-125
0.069
4
7mer
513-531
0.005
Not Conserved
XLOC_000371
hsa-miR-1910-5p
0.979

Gene Details
Chromosome: chr1
Transcript: TCONS_00001130
Biotype: transcript isomorph
Gene id: XLOC_000371
Gene Name: XLOC_000371
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-51
0.074
2
USP46-AS1
hsa-miR-1910-5p
0.978

Gene Details
Chromosome: 4
Transcript: ENST00000503051
Biotype: lincRNA
Gene id: ENSG00000248866
Gene Name: USP46-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1029-1047
0.061
2
7mer
143-149
0.011
2
XLOC_002217
hsa-miR-1910-5p
0.974

Gene Details
Chromosome: chr2
Transcript: TCONS_00003334
Biotype: transcript isomorph
Gene id: XLOC_002217
Gene Name: XLOC_002217
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
12-36
0.070
1
AC159540.3
hsa-miR-1910-5p
0.974

Gene Details
Chromosome: 2
Transcript: ENST00000422600
Biotype: lincRNA
Gene id: ENSG00000237837
Gene Name: AC159540.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
520-544
0.070
1
RP11-437F6.1
hsa-miR-1910-5p
0.968

Gene Details
Chromosome: 12
Transcript: ENST00000546118
Biotype: antisense
Gene id: ENSG00000256473
Gene Name: RP11-437F6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
272-287
0.035
3
8mer
305-311
0.031
2
RP11-24M17.4
hsa-miR-1910-5p
0.964

Gene Details
Chromosome: 15
Transcript: ENST00000569596
Biotype: lincRNA
Gene id: ENSG00000260288
Gene Name: RP11-24M17.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
466-483
0.065
2
XLOC_002079
hsa-miR-1910-5p
0.959

Gene Details
Chromosome: chr2
Transcript: TCONS_00005139
Biotype: transcript isomorph
Gene id: XLOC_002079
Gene Name: XLOC_002079
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1494-1516
0.004
2
6mer
1444-1467
0.004
2
6mer
1372-1385
0.003
2
6mer
1518-1541
0.003
2
6mer
1348-1361
0.003
2
6mer
1103-1125
0.003
3
6mer
1274-1297
0.003
2
6mer
1469-1492
0.003
1
6mer
1324-1337
0.003
2
6mer
1152-1175
0.003
2
6mer
540-562
0.002
2
6mer
1201-1214
0.002
2
6mer
1299-1322
0.002
1
6mer
1249-1272
0.002
1
6mer
515-536
0.002
2
6mer
710-723
0.002
2
6mer
980-1003
0.002
2
6mer
685-700
0.002
2
6mer
1177-1190
0.002
1
6mer
612-634
0.002
1
6mer
1054-1076
0.001
1
6mer
734-755
0.001
2
6mer
1005-1027
0.001
1
6mer
955-978
0.001
1
6mer
857-879
0.001
1
6mer
906-929
0.001
2
6mer
661-674
0.001
1
6mer
759-781
0.001
1
6mer
832-855
0.001
1
6mer
931-953
0.001
1
6mer
808-830
0.001
1
RP11-216M21.7
hsa-miR-1910-5p
0.958

Gene Details
Chromosome: 9
Transcript: ENST00000450520
Biotype: lincRNA
Gene id: ENSG00000233207
Gene Name: RP11-216M21.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
495-510
0.062
1
KCNQ1OT1
hsa-miR-1910-5p
0.956

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
63894-63914
0.006
1
7mer
76906-76928
0.004
3
7mer
37738-37761
0.003
1
7mer
85960-85974
0.003
3
7mer
64463-64488
0.003
2
6mer
21011-21025
0.003
2
6mer
23263-23270
0.002
2
6mer
15918-15928
0.002
1
6mer
20128-20143
0.002
2
6mer
49464-49484
0.002
2
6mer
78708-78720
0.002
3
7mer
36950-36964
0.002
1
6mer
50649-50662
0.002
2
6mer
26459-26472
0.002
1
6mer
65424-65438
0.002
1
6mer
25052-25066
0.002
Not Conserved
6mer
30524-30533
0.002
1
6mer
59579-59603
0.002
2
6mer
84870-84897
0.001
1
6mer
90387-90409
0.001
2
6mer
73467-73482
0.001
2
6mer
9342-9355
0.001
2
6mer
57863-57876
0.001
2
6mer
55768-55794
0.001
1
8mer+mismatch
53270-53289
0.001
2
8mer
36588-36602
0.001
1
6mer
88032-88058
0.001
2
6mer
63457-63475
0.001
2
6mer
64095-64113
0.001
1
6mer
83748-83766
0.001
2
6mer
54412-54434
0.001
1
6mer
55342-55368
0.001
2
6mer
77400-77417
0.001
1
6mer
82162-82189
0.001
1
Funded by: