Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-20a-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
175909-175927
0.014
4
9mer
89496-89519
0.013
4
8mer
10725-10745
0.012
1
8mer
14011-14035
0.012
1
8mer
165221-165239
0.011
5
8mer
220519-220543
0.009
2
8mer
52894-52910
0.008
5
8mer
107247-107269
0.008
2
8mer
225492-225516
0.008
2
8mer
178035-178056
0.007
2
8mer
251110-251133
0.007
1
7mer
50478-50500
0.006
1
7mer
133489-133512
0.006
2
7mer
193799-193819
0.006
1
7mer
16898-16922
0.005
2
9mer
256647-256667
0.005
1
7mer
924-934
0.005
2
8mer
199223-199247
0.005
2
7mer
92503-92525
0.005
3
8mer
52131-52155
0.005
2
7mer
161222-161243
0.005
1
7mer
172347-172358
0.005
3
7mer
80779-80799
0.005
2
7mer
127892-127913
0.004
1
8mer
155511-155532
0.004
2
8mer
67833-67857
0.004
2
7mer
56232-56249
0.004
2
8mer
180846-180864
0.004
2
8mer
221547-221567
0.004
2
8mer
234646-234670
0.004
2
8mer
213967-213982
0.004
3
8mer
261772-261791
0.004
1
7mer
160691-160714
0.004
4
8mer
250219-250246
0.004
1
7mer
175132-175156
0.004
3
7mer
81576-81599
0.004
7
7mer
199899-199916
0.004
2
8mer
244863-244887
0.004
1
8mer
77174-77194
0.004
2
8mer
67545-67569
0.003
2
8mer
11449-11473
0.003
2
8mer
27724-27745
0.003
1
8mer
14156-14180
0.003
2
8mer
236472-236496
0.003
2
8mer
135104-135131
0.003
2
8mer
109484-109504
0.003
2
6mer
131792-131819
0.003
8
8mer
38248-38267
0.003
2
7mer
104450-104470
0.003
3
7mer
145524-145539
0.003
1
8mer
239060-239080
0.003
2
8mer
237872-237892
0.003
2
8mer
262098-262117
0.003
2
8mer
102888-102907
0.003
2
8mer
188881-188905
0.003
2
8mer
249438-249458
0.003
1
8mer
225068-225092
0.003
2
8mer
253387-253411
0.003
2
8mer
64967-64991
0.003
2
8mer
122233-122252
0.003
2
6mer
100356-100378
0.003
8
8mer
223514-223538
0.003
2
6mer
267034-267054
0.003
1
8mer
251548-251572
0.003
1
8mer
114894-114918
0.003
2
8mer
192473-192497
0.003
1
8mer
60218-60242
0.003
2
8mer
252057-252081
0.003
2
8mer
187101-187125
0.003
1
6mer
182709-182734
0.003
8
8mer
14855-14875
0.003
1
6mer
145004-145029
0.003
8
8mer
231650-231673
0.003
1
8mer
263098-263122
0.003
1
8mer
73054-73074
0.003
1
8mer
213280-213300
0.003
1
8mer
174440-174464
0.003
1
7mer
101870-101879
0.003
2
8mer
8822-8842
0.003
1
7mer
166755-166774
0.003
2
6mer
150454-150475
0.003
6
7mer
236279-236300
0.003
1
6mer
127550-127569
0.003
3
6mer
145672-145695
0.002
9
7mer
219872-219892
0.002
2
6mer
183329-183354
0.002
5
8mer
84837-84855
0.002
3
8mer
206108-206131
0.002
1
6mer
17522-17546
0.002
2
8mer
209139-209159
0.002
2
8mer
45037-45061
0.002
1
8mer
247889-247909
0.002
1
8mer
37464-37484
0.002
Not Conserved
6mer
131045-131064
0.002
2
8mer
193330-193349
0.002
Not Conserved
6mer
43071-43091
0.002
2
6mer
169328-169340
0.002
1
6mer
197119-197137
0.002
2
6mer
131353-131375
0.002
4
7mer
23495-23517
0.002
2
8mer
177417-177441
0.002
2
6mer
166143-166167
0.002
4
6mer
254578-254600
0.002
6
8mer
181146-181170
0.002
Not Conserved
6mer
52419-52433
0.002
5
6mer
13490-13513
0.002
2
6mer
203679-203700
0.002
1
8mer
202786-202806
0.002
Not Conserved
6mer
71209-71234
0.002
2
8mer
167715-167739
0.002
2
6mer
116863-116887
0.002
2
7mer
121444-121464
0.002
2
6mer
11217-11244
0.002
2
6mer
69920-69943
0.002
2
8mer
231045-231065
0.002
1
6mer
92171-92189
0.002
4
6mer
84812-84832
0.002
4
6mer
250848-250868
0.002
1
6mer
51815-51832
0.002
4
6mer
94125-94141
0.002
6
6mer
260794-260814
0.002
2
6mer
151340-151355
0.002
3
6mer
157689-157716
0.002
2
6mer
184854-184867
0.002
2
6mer
4883-4900
0.002
2
6mer
92343-92366
0.002
2
6mer
198075-198094
0.002
1
6mer
175015-175037
0.002
1
6mer
140740-140767
0.002
2
6mer
109797-109817
0.002
2
6mer
202300-202318
0.002
Not Conserved
6mer
18591-18611
0.002
2
6mer
89889-89915
0.002
2
6mer
147616-147640
0.002
3
6mer
100982-101000
0.002
3
6mer
160525-160540
0.002
1
6mer
109029-109039
0.002
2
6mer
57314-57324
0.002
2
6mer
185776-185802
0.002
3
6mer
187396-187413
0.002
4
6mer
244007-244026
0.002
2
6mer
150806-150811
0.002
1
6mer
136113-136131
0.002
2
6mer
175535-175557
0.002
2
6mer
194481-194494
0.002
2
6mer
60609-60632
0.002
2
6mer
250001-250021
0.001
1
6mer
177312-177337
0.001
2
6mer
113936-113955
0.001
2
6mer
153974-153999
0.001
2
6mer
179077-179103
0.001
2
6mer
41174-41199
0.001
2
6mer
30049-30073
0.001
2
6mer
30917-30934
0.001
2
8mer
250901-250921
0.001
1
6mer
195841-195863
0.001
2
6mer
157979-157998
0.001
3
6mer
23365-23379
0.001
1
6mer
80075-80096
0.001
Not Conserved
6mer
154794-154815
0.001
3
6mer
61676-61700
0.001
2
6mer
167575-167594
0.001
1
6mer
240516-240543
0.001
2
6mer
152913-152934
0.001
1
6mer
173807-173824
0.001
2
6mer
48790-48810
0.001
3
6mer
182848-182871
0.001
4
6mer
255694-255713
0.001
2
6mer
68855-68875
0.001
2
6mer
126390-126416
0.001
2
6mer
5567-5585
0.001
4
6mer
31416-31439
0.001
2
6mer
245771-245785
0.001
1
8mer
234713-234732
0.001
1
6mer
115879-115906
0.001
2
6mer
255302-255322
0.001
2
6mer
228162-228174
0.001
2
6mer
35799-35820
0.001
1
6mer
98431-98447
0.001
1
6mer
240004-240028
0.001
2
6mer
163799-163820
0.001
3
6mer
146312-146338
0.001
Not Conserved
6mer
200831-200853
0.001
1
6mer
45889-45904
0.001
2
6mer
35333-35354
0.001
2
6mer
31759-31786
0.001
Not Conserved
6mer
242479-242491
0.001
1
6mer
85203-85227
0.001
2
6mer
183662-183686
0.001
1
6mer
240912-240936
0.001
2
6mer
121086-121105
0.001
1
6mer
217106-217122
0.001
1
6mer
92554-92569
0.001
1
6mer
73377-73397
0.001
1
6mer
177823-177843
0.001
2
6mer
134404-134430
0.001
2
6mer
153365-153389
0.001
1
6mer
154894-154916
0.001
2
6mer
89910-89935
0.001
2
6mer
217220-217242
0.001
1
7mer
100419-100442
0.000
1
COX10-AS1
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000623598
Biotype: TEC
Gene id: ENSG00000236088
Gene Name: COX10-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1822-1849
0.205
1
6mer
144-164
0.004
Not Conserved
6mer
365-384
0.003
Not Conserved
TSIX
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
32816-32843
0.041
5
9mer
36146-36168
0.037
4
8mer
33127-33153
0.015
3
7mer
4833-4853
0.009
4
7mer
33542-33565
0.008
5
8mer
33-57
0.008
1
9mer
30777-30803
0.008
2
7mer
35703-35728
0.006
4
7mer
2347-2373
0.006
1
7mer
28099-28120
0.005
1
6mer
36429-36448
0.004
2
7mer
30746-30767
0.004
2
7mer
20937-20956
0.004
1
7mer
34032-34042
0.003
3
8mer
5219-5246
0.003
2
8mer
3393-3413
0.003
2
8mer
27462-27482
0.003
2
8mer
7150-7174
0.003
1
6mer
23868-23884
0.003
3
6mer
19899-19916
0.002
3
6mer
32085-32110
0.002
3
6mer
2181-2200
0.002
2
6mer
31403-31416
0.002
Not Conserved
6mer
7767-7782
0.002
1
6mer
19489-19508
0.001
2
6mer
10091-10105
0.001
Not Conserved
6mer
6015-6029
0.001
2
6mer
27886-27906
0.001
2
6mer
20456-20481
0.001
1
6mer
8126-8151
0.001
1
6mer
24335-24359
0.001
2
6mer
3828-3842
0.001
1
6mer
22858-22869
0.001
2
6mer
20024-20042
0.001
2
6mer
23903-23920
0.001
2
6mer
8147-8166
0.000
1
RP13-753N3.1
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000584157
Biotype: antisense
Gene id: ENSG00000263531
Gene Name: RP13-753N3.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
5-24
0.072
1
8mer
515-542
0.060
1
8mer
141-161
0.055
1
CTD-2015H6.3
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: 5
Transcript: ENST00000504300
Biotype: antisense
Gene id: ENSG00000249042
Gene Name: CTD-2015H6.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
50-73
0.173
3
8mer
418-438
0.013
2
XLOC_000782
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: chr1
Transcript: TCONS_00001452
Biotype: transcript isomorph
Gene id: XLOC_000782
Gene Name: XLOC_000782
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2280-2301
0.164
1
6mer
1033-1049
0.008
1
TTTY10
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: Y
Transcript: ENST00000455084
Biotype: lincRNA
Gene id: ENSG00000229236
Gene Name: TTTY10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
249-275
0.144
1
6mer
204-216
0.017
1
6mer
591-613
0.011
1
RP1-184J9.2
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000427154
Biotype: antisense
Gene id: ENSG00000240553
Gene Name: RP1-184J9.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
485-496
0.159
11
XLOC_003276
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: chr3
Transcript: TCONS_00006679
Biotype: transcript isomorph
Gene id: XLOC_003276
Gene Name: XLOC_003276
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
43-64
0.135
8
6mer
11-29
0.016
8
PVRL3-AS1
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: 3
Transcript: ENST00000467426
Biotype: antisense
Gene id: ENSG00000242242
Gene Name: PVRL3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
602-623
0.150
7
CTD-2015H6.3
hsa-miR-20a-5p
1.000

Gene Details
Chromosome: 5
Transcript: ENST00000508000
Biotype: antisense
Gene id: ENSG00000249042
Gene Name: CTD-2015H6.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
469-492
0.112
3
8mer
837-857
0.013
2
6mer
92-110
0.008
2
6mer
339-360
0.005
2
XLOC_010384
hsa-miR-20a-5p
0.999

Gene Details
Chromosome: chr13
Transcript: TCONS_00021786
Biotype: transcript isomorph
Gene id: XLOC_010384
Gene Name: XLOC_010384
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
606-626
0.055
5
9mer
513-534
0.052
1
7mer
1027-1049
0.012
4
6mer
402-419
0.007
5
6mer
14-31
0.007
5
RP11-13N13.5
hsa-miR-20a-5p
0.999

Gene Details
Chromosome: 18
Transcript: ENST00000584148
Biotype: sense_intronic
Gene id: ENSG00000264188
Gene Name: RP11-13N13.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
308-332
0.076
1
8mer
146-170
0.057
1
KCNQ1OT1
hsa-miR-20a-5p
0.999

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
34858-34877
0.014
1
8mer
38449-38469
0.011
1
7mer
18887-18904
0.009
2
8mer
422-446
0.008
2
9mer
71825-71845
0.006
1
7mer
3551-3568
0.006
1
7mer
49635-49653
0.005
2
8mer
12911-12931
0.005
2
8mer
18462-18480
0.004
2
7mer
82195-82218
0.003
1
6mer
51719-51736
0.003
5
7mer
33395-33411
0.003
1
7mer
1582-1601
0.003
1
8mer
12149-12173
0.003
1
6mer
1283-1299
0.003
2
7mer
71147-71171
0.003
1
6mer
55121-55142
0.002
5
6mer
87689-87705
0.002
2
6mer
44239-44257
0.002
3
6mer
66986-67005
0.002
2
6mer
27365-27382
0.002
1
6mer
47048-47071
0.002
4
8mer+mismatch
70775-70797
0.002
3
6mer
88674-88700
0.002
3
6mer
18523-18545
0.002
2
6mer
49061-49085
0.002
3
7mer
70752-70773
0.002
Not Conserved
6mer
89348-89366
0.002
2
6mer
21876-21895
0.002
1
6mer
38713-38733
0.001
1
6mer
22524-22543
0.001
1
6mer
17823-17839
0.001
1
6mer
86894-86904
0.001
1
6mer
78737-78749
0.001
1
6mer
14120-14145
0.001
1
6mer
35619-35644
0.001
1
6mer
77778-77799
0.001
2
6mer
73170-73193
0.001
2
6mer
51356-51377
0.001
2
6mer
52228-52254
0.001
2
6mer
52214-52238
0.001
2
6mer
71134-71149
0.001
1
RP11-374M1.2
hsa-miR-20a-5p
0.999

Gene Details
Chromosome: 9
Transcript: ENST00000612999
Biotype: retained_intron
Gene id: ENSG00000231527
Gene Name: RP11-374M1.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
154-173
0.077
2
8mer
1279-1299
0.048
1
RP11-363E7.4
hsa-miR-20a-5p
0.999

Gene Details
Chromosome: 9
Transcript: ENST00000563205
Biotype: sense_overlapping
Gene id: ENSG00000260912
Gene Name: RP11-363E7.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1726-1749
0.108
9
6mer
102-115
0.005
2
6mer
1506-1516
0.005
3
6mer
626-647
0.003
1
RP11-531F16.4
hsa-miR-20a-5p
0.998

Gene Details
Chromosome: 3
Transcript: ENST00000608000
Biotype: antisense
Gene id: ENSG00000273261
Gene Name: RP11-531F16.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
100-123
0.104
4
6mer
395-415
0.006
3
6mer
345-372
0.005
6
AC002519.8
hsa-miR-20a-5p
0.998

Gene Details
Chromosome: 16
Transcript: ENST00000570073
Biotype: sense_intronic
Gene id: ENSG00000259810
Gene Name: AC002519.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2057-2077
0.059
2
8mer
1133-1157
0.033
2
6mer
2770-2791
0.017
2
6mer
723-741
0.005
1
RP11-374M1.2
hsa-miR-20a-5p
0.998

Gene Details
Chromosome: 9
Transcript: ENST00000399894
Biotype: lincRNA
Gene id: ENSG00000231527
Gene Name: RP11-374M1.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
128-147
0.068
2
8mer
421-441
0.044
1
XLOC_007290
hsa-miR-20a-5p
0.997

Gene Details
Chromosome: chr9
Transcript: TCONS_00015925
Biotype: transcript isomorph
Gene id: XLOC_007290
Gene Name: XLOC_007290
UCSC graphic: -
Expression:
  Cell Line Tissue Category
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-20a-5p
Sequence: uaaagugcuuauagugcagguag
MirBase ID: MIMAT0000075
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1408-1432
0.107
4
Funded by: