Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-21-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-21-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
163162-163184
0.015
9
8mer
98274-98294
0.009
2
8mer
92585-92610
0.007
2
7mer
133420-133440
0.007
1
7mer
171112-171133
0.006
2
7mer
166504-166516
0.006
6
8mer
35633-35659
0.005
1
7mer
89041-89061
0.005
2
7mer
97351-97368
0.004
2
7mer
36564-36583
0.004
1
7mer
79598-79610
0.004
2
7mer
183660-183677
0.004
4
8mer+wobble
117616-117636
0.003
2
7mer
185008-185031
0.003
2
7mer
100924-100945
0.003
2
7mer
61803-61809
0.003
2
6mer
126961-126981
0.003
7
6mer
124930-124942
0.003
5
8mer+wobble
210038-210061
0.003
1
6mer
5813-5839
0.003
5
6mer
158460-158473
0.003
2
7mer
171187-171206
0.003
1
6mer
149439-149460
0.002
7
7mer
82691-82713
0.002
2
6mer
81414-81426
0.002
9
6mer
123923-123947
0.002
7
6mer
128067-128071
0.002
2
6mer
217129-217146
0.002
2
6mer
1182-1200
0.002
5
6mer
128997-129014
0.002
6
6mer
249729-249750
0.002
1
6mer
159826-159850
0.002
2
6mer
89311-89335
0.002
5
6mer
181727-181749
0.002
1
6mer
11198-11215
0.002
2
6mer
205663-205689
0.002
2
6mer
154762-154766
0.002
4
6mer
16033-16050
0.002
3
6mer
125417-125441
0.002
7
6mer
168546-168571
0.002
2
6mer
63767-63787
0.002
2
6mer
214356-214382
0.002
3
7mer
33539-33551
0.002
3
6mer
112338-112360
0.002
5
6mer
184720-184735
0.002
2
6mer
53878-53901
0.002
2
6mer
182545-182563
0.002
2
6mer
59420-59429
0.002
2
6mer
144539-144555
0.002
5
6mer
69120-69146
0.002
Not Conserved
6mer
249388-249410
0.002
1
6mer
110624-110649
0.001
2
6mer
55207-55231
0.001
1
6mer
33493-33514
0.001
5
6mer
230624-230637
0.001
1
6mer
174754-174773
0.001
3
6mer
13850-13854
0.001
1
6mer
108495-108520
0.001
2
6mer
30667-30690
0.001
2
6mer
52293-52314
0.001
2
6mer
29657-29682
0.001
1
6mer
256313-256329
0.001
2
6mer
140201-140224
0.001
3
6mer
72273-72287
0.001
1
6mer
172580-172603
0.001
2
6mer
145146-145160
0.001
1
6mer
144814-144834
0.001
1
6mer
263031-263053
0.001
1
6mer
13415-13431
0.001
2
6mer
12003-12024
0.001
1
6mer
28892-28919
0.001
2
6mer
126584-126598
0.001
2
6mer
171352-171371
0.001
1
6mer
246353-246377
0.001
1
6mer
205470-205490
0.001
1
6mer
189303-189317
0.001
2
6mer
66662-66680
0.001
2
6mer
4863-4886
0.001
Not Conserved
6mer
84249-84274
0.001
3
6mer
21281-21299
0.001
2
6mer
171142-171162
0.001
1
6mer
5820-5843
0.000
1
6mer
145158-145172
0.000
2
6mer
81417-81439
0.000
2
RP11-20A20.2
hsa-miR-21-5p
1.000

Gene Details
Chromosome: 9
Transcript: ENST00000602614
Biotype: lincRNA
Gene id: ENSG00000269957
Gene Name: RP11-20A20.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
392-419
0.150
11
8mer
268-292
0.038
2
XLOC_013703
hsa-miR-21-5p
0.999

Gene Details
Chromosome: chr20
Transcript: TCONS_00028028
Biotype: transcript isomorph
Gene id: XLOC_013703
Gene Name: XLOC_013703
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
666-685
0.092
1
7mer
64-89
0.034
1
XLOC_009222
hsa-miR-21-5p
0.996

Gene Details
Chromosome: chr11
Transcript: TCONS_00019399
Biotype: transcript isomorph
Gene id: XLOC_009222
Gene Name: XLOC_009222
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3347-3364
0.055
1
7mer
5726-5747
0.023
1
6mer
5959-5981
0.013
1
6mer
4719-4735
0.006
1
6mer
1355-1381
0.005
1
6mer
2955-2959
0.002
Not Conserved
KB-1615E4.2
hsa-miR-21-5p
0.995

Gene Details
Chromosome: 8
Transcript: ENST00000523831
Biotype: antisense
Gene id: ENSG00000253666
Gene Name: KB-1615E4.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
303-322
0.057
2
8mer
285-306
0.041
1
XLOC_007304
hsa-miR-21-5p
0.990

Gene Details
Chromosome: chr9
Transcript: TCONS_00016545
Biotype: transcript isomorph
Gene id: XLOC_007304
Gene Name: XLOC_007304
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1017-1044
0.064
11
8mer
864-888
0.022
2
RP11-219J21.2
hsa-miR-21-5p
0.986

Gene Details
Chromosome: 8
Transcript: ENST00000522524
Biotype: lincRNA
Gene id: ENSG00000253342
Gene Name: RP11-219J21.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
444-464
0.080
1
AC005235.1
hsa-miR-21-5p
0.985

Gene Details
Chromosome: 2
Transcript: ENST00000443261
Biotype: lincRNA
Gene id: ENSG00000236653
Gene Name: AC005235.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
276-297
0.051
7
7mer
266-285
0.028
9
CTC-428H11.2
hsa-miR-21-5p
0.982

Gene Details
Chromosome: 5
Transcript: ENST00000607486
Biotype: antisense
Gene id: ENSG00000272367
Gene Name: CTC-428H11.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
624-650
0.061
9
7mer
405-427
0.015
4
RP11-210K20.2
hsa-miR-21-5p
0.981

Gene Details
Chromosome: 18
Transcript: ENST00000582269
Biotype: antisense
Gene id: ENSG00000263924
Gene Name: RP11-210K20.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
55-79
0.070
3
6mer
143-167
0.005
2
AC006548.28
hsa-miR-21-5p
0.981

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
54382-54405
0.009
Not Conserved
7mer
63596-63623
0.007
2
8mer
28737-28751
0.007
2
8mer
77831-77853
0.007
1
6mer
84196-84212
0.004
1
8mer
70531-70550
0.004
1
7mer
37431-37456
0.004
1
7mer
57019-57043
0.004
2
7mer
61090-61110
0.004
2
6mer
73633-73651
0.002
2
6mer
59203-59216
0.002
2
6mer
41668-41683
0.002
3
6mer
61502-61515
0.002
2
6mer
81034-81059
0.002
2
6mer
2443-2466
0.002
2
6mer
42732-42757
0.002
1
6mer
21713-21726
0.002
3
6mer
51475-51489
0.002
Not Conserved
6mer
22760-22785
0.002
3
6mer
37477-37498
0.001
2
6mer
50814-50832
0.001
Not Conserved
6mer
72462-72475
0.001
1
6mer
48442-48469
0.001
Not Conserved
6mer
49596-49611
0.001
Not Conserved
6mer
72178-72198
0.001
Not Conserved
XLOC_010383
hsa-miR-21-5p
0.980

Gene Details
Chromosome: chr13
Transcript: TCONS_00021785
Biotype: transcript isomorph
Gene id: XLOC_010383
Gene Name: XLOC_010383
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
- Ovary Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
934-951
0.040
1
7mer
270-287
0.034
1
KCNQ1OT1
hsa-miR-21-5p
0.977

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
20217-20237
0.014
1
9mer
16102-16126
0.007
Not Conserved
7mer
41611-41636
0.007
2
7mer
52710-52728
0.006
2
7mer
35108-35132
0.005
1
7mer
49693-49715
0.004
1
6mer
75183-75208
0.003
3
6mer
87513-87538
0.002
2
6mer
30810-30831
0.002
1
6mer
45098-45119
0.002
3
6mer
27739-27766
0.002
1
6mer
41224-41233
0.002
2
6mer
73939-73954
0.002
2
6mer
18187-18203
0.002
2
6mer
50492-50511
0.002
2
6mer
30108-30126
0.002
1
6mer
78688-78711
0.002
2
6mer
52576-52602
0.001
2
6mer
73260-73279
0.001
2
6mer
83276-83297
0.001
1
6mer
68296-68316
0.001
2
6mer
3579-3601
0.001
1
6mer
28895-28910
0.001
1
6mer
75485-75506
0.001
1
8mer+wobble
78622-78642
0.001
2
6mer
75403-75421
0.001
2
AC000120.7
hsa-miR-21-5p
0.976

Gene Details
Chromosome: 7
Transcript: ENST00000414227
Biotype: sense_overlapping
Gene id: ENSG00000243107
Gene Name: AC000120.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
223-239
0.058
7
6mer
151-173
0.007
5
6mer
510-536
0.007
5
RP11-6N13.4
hsa-miR-21-5p
0.974

Gene Details
Chromosome: 5
Transcript: ENST00000523745
Biotype: lincRNA
Gene id: ENSG00000253776
Gene Name: RP11-6N13.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
490-512
0.055
Not Conserved
6mer
305-331
0.015
2
LOC101926935
hsa-miR-21-5p
0.974

Gene Details
Chromosome: 20
Transcript: NR_110001.1
Biotype: sense
Gene id: NR_110001.1 (gene)
Gene Name: LOC101926935
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4505-4521
0.050
1
7mer
2591-2617
0.020
1
MIR6818
hsa-miR-21-5p
0.973

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
6019-6037
0.015
3
7mer
9541-9559
0.011
11
7mer
23289-23312
0.006
2
7mer
38029-38046
0.003
3
7mer
22809-22828
0.003
2
7mer
32941-32965
0.002
2
6mer
29815-29831
0.002
2
6mer
44987-44999
0.002
1
6mer
3930-3955
0.002
4
6mer
18604-18624
0.002
2
6mer
24349-24362
0.002
4
6mer
18292-18315
0.002
4
6mer
32380-32393
0.002
2
6mer
9019-9035
0.002
2
6mer
44178-44204
0.002
3
6mer
35106-35124
0.002
1
6mer
1858-1878
0.002
3
6mer
6465-6490
0.001
2
8mer
23226-23238
0.001
1
6mer
36001-36028
0.001
1
6mer
38339-38360
0.001
1
6mer
17154-17179
0.001
1
6mer
25490-25508
0.001
2
6mer
16115-16128
0.001
1
6mer
8892-8912
0.001
Not Conserved
RP1-309I22.2
hsa-miR-21-5p
0.970

Gene Details
Chromosome: 22
Transcript: ENST00000624184
Biotype: sense_overlapping
Gene id: ENSG00000279338
Gene Name: RP1-309I22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25041-25063
0.023
8
8mer
23694-23710
0.015
6
7mer
17026-17053
0.009
4
7mer
1389-1405
0.006
2
6mer
7584-7609
0.002
3
6mer
16824-16840
0.002
3
6mer
26940-26958
0.002
2
6mer
16135-16155
0.002
2
6mer
7746-7766
0.001
1
6mer
18805-18827
0.001
3
6mer
20600-20623
0.001
4
6mer
14328-14350
0.001
3
6mer
22309-22327
0.001
2
6mer
12226-12249
0.001
1
AC009299.2
hsa-miR-21-5p
0.963

Gene Details
Chromosome: 2
Transcript: ENST00000610254
Biotype: antisense
Gene id: ENSG00000235724
Gene Name: AC009299.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
97-113
0.058
12
6mer
288-312
0.006
5
LINC01079
hsa-miR-21-5p
0.959

Gene Details
Chromosome: 13
Transcript: ENST00000431171
Biotype: lincRNA
Gene id: ENSG00000229609
Gene Name: LINC01079
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-21-5p
Sequence: uagcuuaucagacugauguuga
MirBase ID: MIMAT0000076
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
158-181
0.060
4
6mer
212-236
0.002
Not Conserved
Funded by: