Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-29b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-29b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
245494-245517
0.031
1
8mer
168675-168693
0.021
11
8mer
110605-110618
0.015
2
8mer
252443-252461
0.010
2
8mer
165093-165111
0.009
3
8mer
153910-153922
0.006
2
7mer
99939-99964
0.006
7
7mer
130630-130645
0.006
4
8mer
230545-230555
0.006
Not Conserved
7mer
258044-258071
0.005
1
8mer
206770-206789
0.004
Not Conserved
7mer
6880-6894
0.004
4
7mer
58130-58154
0.004
2
7mer
116105-116128
0.004
2
8mer
217843-217854
0.003
2
7mer
3215-3240
0.003
2
8mer
119883-119904
0.003
3
7mer
149086-149104
0.003
2
7mer
166813-166839
0.003
3
6mer
74634-74653
0.002
8
6mer
144126-144141
0.002
5
7mer
130470-130485
0.002
4
7mer
197073-197087
0.002
2
7mer
67326-67342
0.002
2
6mer
144750-144767
0.002
7
6mer
5932-5955
0.002
4
6mer
191338-191363
0.002
1
6mer
168344-168364
0.002
3
6mer
132331-132347
0.002
7
7mer
32315-32337
0.002
2
6mer
49177-49196
0.002
2
6mer
153072-153098
0.002
2
7mer
87831-87856
0.002
2
6mer
97662-97676
0.002
2
6mer
109198-109224
0.002
2
6mer
210781-210798
0.001
1
6mer
240705-240725
0.001
2
6mer
152571-152596
0.001
2
6mer
20143-20158
0.001
3
6mer
182153-182168
0.001
3
6mer
62150-62168
0.001
3
6mer
157063-157085
0.001
2
6mer
202128-202146
0.001
Not Conserved
6mer
22948-22970
0.001
2
6mer
244923-244941
0.001
1
6mer
123133-123150
0.001
3
6mer
56091-56105
0.001
3
6mer
81130-81150
0.001
2
6mer
190417-190437
0.001
1
6mer
60658-60681
0.001
3
6mer
188305-188324
0.001
2
6mer
24007-24034
0.001
Not Conserved
6mer
229501-229522
0.001
1
6mer
120653-120678
0.001
2
6mer
67199-67225
0.001
2
6mer
42098-42102
0.001
2
6mer
223625-223648
0.001
1
6mer
133915-133935
0.001
1
6mer
127724-127740
0.001
1
6mer
22126-22137
0.001
2
6mer
148836-148858
0.001
1
6mer
143249-143265
0.001
2
6mer
12434-12454
0.001
1
6mer
162882-162908
0.001
2
6mer
214118-214139
0.001
3
6mer
53857-53871
0.001
2
7mer
22963-22983
0.001
2
6mer
39660-39684
0.001
1
6mer
214684-214698
0.001
1
LINC00377
hsa-miR-29b-3p
1.000

Gene Details
Chromosome: 13
Transcript: ENST00000456588
Biotype: lincRNA
Gene id: ENSG00000229246
Gene Name: LINC00377
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
372-391
0.156
2
7mer
301-324
0.014
1
H19
hsa-miR-29b-3p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000447298
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
221-242
0.147
6
H19
hsa-miR-29b-3p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000428066
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
226-247
0.147
6
RP11-272L13.3
hsa-miR-29b-3p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000602672
Biotype: lincRNA
Gene id: ENSG00000269998
Gene Name: RP11-272L13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
215-235
0.139
11
H19
hsa-miR-29b-3p
0.999

Gene Details
Chromosome: 11
Transcript: ENST00000436715
Biotype: retained_intron
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
470-484
0.118
6
XLOC_010279
hsa-miR-29b-3p
0.998

Gene Details
Chromosome: chr12
Transcript: TCONS_00020261
Biotype: transcript isomorph
Gene id: XLOC_010279
Gene Name: XLOC_010279
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1928-1952
0.069
1
7mer
221-247
0.045
1
H19
hsa-miR-29b-3p
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000431095
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
672-693
0.109
6
6mer
1418-1442
0.004
1
H19
hsa-miR-29b-3p
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000411754
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
672-693
0.109
6
6mer
1743-1767
0.003
1
H19
hsa-miR-29b-3p
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000446406
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
693-714
0.107
6
6mer
1537-1561
0.003
1
AC006548.28
hsa-miR-29b-3p
0.998

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
45671-45684
0.013
Not Conserved
7mer
72855-72870
0.012
2
8mer
3272-3286
0.009
3
8mer
2019-2033
0.008
2
8mer
47796-47822
0.007
Not Conserved
8mer
71349-71369
0.007
Not Conserved
7mer
33824-33843
0.005
1
8mer
8096-8114
0.004
2
7mer
40616-40628
0.004
2
7mer
27647-27669
0.003
2
7mer
13498-13518
0.003
2
7mer
53302-53324
0.003
Not Conserved
7mer
63086-63104
0.002
2
7mer
62068-62084
0.002
1
7mer
37153-37175
0.002
1
8mer+mismatch
3672-3691
0.002
2
7mer
38169-38195
0.002
Not Conserved
7mer
13111-13132
0.002
2
6mer
42397-42414
0.002
1
6mer
77062-77079
0.002
Not Conserved
6mer
17924-17944
0.001
2
6mer
76747-76762
0.001
1
6mer
53615-53632
0.001
Not Conserved
7mer
23617-23637
0.001
1
6mer
23724-23743
0.001
3
6mer
6447-6460
0.001
2
6mer
64350-64366
0.001
2
6mer
25465-25488
0.001
2
6mer
22464-22477
0.001
2
6mer
61864-61886
0.001
1
6mer
45361-45386
0.001
Not Conserved
6mer
47213-47234
0.001
Not Conserved
6mer
62370-62389
0.001
2
6mer
10537-10562
0.001
2
6mer
17785-17801
0.001
2
6mer
3153-3169
0.001
1
6mer
63043-63068
0.000
1
6mer
40549-40563
0.000
2
H19
hsa-miR-29b-3p
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000417089
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
675-696
0.109
6
H19
hsa-miR-29b-3p
0.997

Gene Details
Chromosome: 11
Transcript: ENST00000412788
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
727-748
0.105
6
6mer
2219-2243
0.003
1
AC005154.6
hsa-miR-29b-3p
0.997

Gene Details
Chromosome: 7
Transcript: ENST00000454922
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
318-343
0.064
2
8mer
332-352
0.026
1
7mer
372-399
0.017
2
BLACAT1
hsa-miR-29b-3p
0.997

Gene Details
Chromosome: 1
Transcript: NR_103783.1
Biotype: sense
Gene id: NR_103783.1 (gene)
Gene Name: BLACAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
382-404
0.103
7
H19
hsa-miR-29b-3p
0.996

Gene Details
Chromosome: 11
Transcript: ENST00000422826
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
699-713
0.099
6
6mer
1751-1775
0.004
1
MIR490
hsa-miR-29b-3p
0.995

Gene Details
Chromosome: 7
Transcript: ENST00000439694
Biotype: antisense
Gene id: ENSG00000234352
Gene Name: MIR490
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
575-592
0.081
4
8mer
832-849
0.016
2
H19
hsa-miR-29b-3p
0.995

Gene Details
Chromosome: 11
Transcript: ENST00000414790
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
746-767
0.093
6
6mer
2238-2262
0.003
1
H19
hsa-miR-29b-3p
0.994

Gene Details
Chromosome: 11
Transcript: ENST00000439725
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
733-754
0.095
6
XLOC_013773
hsa-miR-29b-3p
0.994

Gene Details
Chromosome: chr20
Transcript: TCONS_00028422
Biotype: transcript isomorph
Gene id: XLOC_013773
Gene Name: XLOC_013773
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-29b-3p
Sequence: uagcaccauuugaaaucaguguu
MirBase ID: MIMAT0000100
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
359-380
0.023
2
8mer
573-594
0.012
2
7mer
151-177
0.010
2
7mer
5592-5613
0.006
1
7mer
256-277
0.005
1
6mer
5699-5724
0.004
1
7mer
786-812
0.004
1
6mer
303-325
0.004
2
7mer
5483-5509
0.003
Not Conserved
7mer
3450-3476
0.003
1
8mer
2834-2852
0.003
1
8mer
1403-1430
0.003
Not Conserved
7mer
626-647
0.002
Not Conserved
6mer
733-759
0.002
1
6mer
517-539
0.002
1
7mer
2627-2653
0.002
1
7mer
1561-1583
0.002
Not Conserved
7mer
3237-3258
0.001
Not Conserved
6mer
1158-1185
0.001
1
6mer
3047-3072
0.001
1
6mer
2358-2379
0.001
1
7mer
2515-2533
0.001
Not Conserved
6mer
2887-2913
0.001
Not Conserved
6mer
2074-2101
0.001
Not Conserved
6mer
2306-2327
0.001
1
6mer
1455-1481
0.000
Not Conserved
6mer
2778-2800
0.000
Not Conserved
Funded by: