Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-29c-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-29c-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
245497-245517
0.036
1
8mer
168675-168693
0.022
11
8mer
110606-110618
0.014
2
8mer
252447-252461
0.010
2
8mer
165092-165111
0.009
3
8mer
153909-153922
0.007
2
7mer
99950-99964
0.006
7
8mer
230544-230555
0.006
Not Conserved
7mer
130632-130645
0.005
4
8mer
206766-206789
0.004
Not Conserved
7mer
258050-258071
0.004
1
7mer
6870-6894
0.004
4
7mer
58132-58154
0.004
2
7mer
116110-116128
0.003
2
8mer
217837-217854
0.003
2
7mer
3222-3240
0.003
2
8mer
119883-119904
0.003
3
6mer
74635-74653
0.003
8
7mer
166814-166839
0.003
3
7mer
149093-149104
0.003
2
6mer
144125-144141
0.002
5
7mer
130469-130485
0.002
4
7mer
197070-197087
0.002
2
7mer
67321-67342
0.002
2
6mer
144745-144767
0.002
7
6mer
5938-5955
0.002
4
6mer
132332-132347
0.002
7
7mer
32317-32337
0.002
2
6mer
191338-191363
0.002
1
6mer
168339-168364
0.002
3
6mer
49178-49196
0.002
2
6mer
97672-97676
0.002
2
6mer
109214-109224
0.002
3
6mer
210784-210798
0.002
1
7mer
87834-87856
0.002
2
6mer
153084-153098
0.002
2
6mer
240705-240725
0.001
2
6mer
152573-152596
0.001
2
6mer
182142-182168
0.001
3
6mer
123135-123150
0.001
3
6mer
20142-20158
0.001
3
6mer
202128-202146
0.001
Not Conserved
6mer
157063-157085
0.001
2
6mer
56101-56105
0.001
3
6mer
244922-244941
0.001
1
6mer
22948-22970
0.001
2
6mer
62150-62168
0.001
3
6mer
190417-190437
0.001
1
6mer
60659-60681
0.001
3
6mer
24013-24034
0.001
Not Conserved
6mer
229503-229522
0.001
1
6mer
81130-81150
0.001
2
6mer
188309-188324
0.001
2
6mer
67208-67225
0.001
2
6mer
223634-223648
0.001
1
6mer
42089-42102
0.001
2
6mer
133919-133935
0.001
1
6mer
22114-22137
0.001
2
6mer
120661-120678
0.001
2
6mer
162883-162908
0.001
2
6mer
12434-12454
0.001
1
6mer
127722-127740
0.001
1
6mer
148833-148858
0.001
1
6mer
214118-214139
0.001
3
7mer
22966-22983
0.001
2
6mer
53855-53871
0.001
2
6mer
143246-143265
0.001
2
6mer
39663-39684
0.001
1
6mer
214684-214698
0.001
1
H19
hsa-miR-29c-3p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000447298
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
221-240
0.143
6
H19
hsa-miR-29c-3p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000428066
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
226-245
0.143
6
RP11-272L13.3
hsa-miR-29c-3p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000602672
Biotype: lincRNA
Gene id: ENSG00000269998
Gene Name: RP11-272L13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
215-239
0.141
11
LINC00377
hsa-miR-29c-3p
1.000

Gene Details
Chromosome: 13
Transcript: ENST00000456588
Biotype: lincRNA
Gene id: ENSG00000229246
Gene Name: LINC00377
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
372-391
0.124
2
7mer
312-324
0.014
1
AC005154.6
hsa-miR-29c-3p
0.999

Gene Details
Chromosome: 7
Transcript: ENST00000454922
Biotype: antisense
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
318-337
0.059
2
8mer
332-352
0.029
1
8mer+wobble
999-1023
0.024
2
7mer
372-391
0.017
2
H19
hsa-miR-29c-3p
0.999

Gene Details
Chromosome: 11
Transcript: ENST00000436715
Biotype: retained_intron
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
470-479
0.117
6
H19
hsa-miR-29c-3p
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000431095
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
672-691
0.106
6
6mer
1418-1439
0.003
1
H19
hsa-miR-29c-3p
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000411754
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
672-691
0.106
6
6mer
1743-1764
0.003
1
AC006548.28
hsa-miR-29c-3p
0.997

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
45671-45684
0.013
Not Conserved
7mer
72855-72869
0.010
2
8mer
3272-3278
0.008
3
8mer
47796-47815
0.008
Not Conserved
8mer
2019-2038
0.007
2
8mer
71349-71368
0.006
Not Conserved
7mer
33824-33843
0.005
1
8mer
8096-8111
0.004
2
7mer
40616-40633
0.004
2
7mer
27647-27667
0.003
2
7mer
13498-13512
0.003
2
7mer
53302-53322
0.003
Not Conserved
7mer
63086-63104
0.002
2
7mer
62068-62080
0.002
1
7mer
37153-37168
0.002
1
8mer+mismatch
3672-3689
0.002
2
7mer
13111-13125
0.002
2
7mer
38169-38193
0.002
Not Conserved
6mer
42397-42411
0.002
1
6mer
77062-77089
0.002
Not Conserved
6mer
17924-17944
0.001
2
6mer
76747-76764
0.001
1
6mer
53615-53629
0.001
Not Conserved
7mer
23617-23637
0.001
1
6mer
23724-23743
0.001
3
6mer
64350-64370
0.001
2
6mer
6447-6460
0.001
2
6mer
25465-25486
0.001
2
6mer
61864-61884
0.001
1
6mer
22464-22484
0.001
2
6mer
62370-62383
0.001
2
6mer
10537-10560
0.001
2
6mer
45361-45378
0.001
Not Conserved
6mer
47213-47233
0.001
Not Conserved
6mer
17785-17799
0.001
2
6mer
3153-3175
0.001
1
6mer
40549-40557
0.000
2
6mer
63043-63062
0.000
1
H19
hsa-miR-29c-3p
0.997

Gene Details
Chromosome: 11
Transcript: ENST00000446406
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
693-712
0.105
6
6mer
1537-1558
0.003
1
H19
hsa-miR-29c-3p
0.997

Gene Details
Chromosome: 11
Transcript: ENST00000417089
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
675-694
0.106
6
H19
hsa-miR-29c-3p
0.997

Gene Details
Chromosome: 11
Transcript: ENST00000412788
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
727-746
0.102
6
6mer
2219-2240
0.003
1
XLOC_010279
hsa-miR-29c-3p
0.996

Gene Details
Chromosome: chr12
Transcript: TCONS_00020261
Biotype: transcript isomorph
Gene id: XLOC_010279
Gene Name: XLOC_010279
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1928-1949
0.060
1
7mer
221-241
0.043
1
H19
hsa-miR-29c-3p
0.996

Gene Details
Chromosome: 11
Transcript: ENST00000422826
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
699-708
0.099
6
6mer
1751-1772
0.003
1
BLACAT1
hsa-miR-29c-3p
0.996

Gene Details
Chromosome: 1
Transcript: NR_103783.1
Biotype: sense
Gene id: NR_103783.1 (gene)
Gene Name: BLACAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
382-399
0.100
7
MIR490
hsa-miR-29c-3p
0.995

Gene Details
Chromosome: 7
Transcript: ENST00000439694
Biotype: antisense
Gene id: ENSG00000234352
Gene Name: MIR490
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
575-596
0.081
4
8mer
832-856
0.016
2
XLOC_013773
hsa-miR-29c-3p
0.994

Gene Details
Chromosome: chr20
Transcript: TCONS_00028422
Biotype: transcript isomorph
Gene id: XLOC_013773
Gene Name: XLOC_013773
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
359-380
0.022
2
8mer
573-594
0.012
2
7mer
151-177
0.011
2
7mer
5592-5618
0.005
1
7mer
256-277
0.005
1
6mer
303-322
0.004
2
6mer
5699-5725
0.004
1
7mer
786-806
0.004
1
7mer
5483-5509
0.003
Not Conserved
7mer
3450-3466
0.003
1
8mer
2834-2852
0.003
1
8mer
1403-1430
0.003
Not Conserved
7mer
626-647
0.002
Not Conserved
6mer
733-759
0.002
1
6mer
517-539
0.002
1
7mer
2627-2653
0.002
1
7mer
1561-1583
0.002
Not Conserved
6mer
1158-1185
0.001
1
7mer
3237-3258
0.001
Not Conserved
6mer
3047-3072
0.001
1
6mer
2358-2379
0.001
1
7mer
2515-2540
0.001
Not Conserved
6mer
2074-2101
0.001
Not Conserved
6mer
2887-2908
0.001
Not Conserved
6mer
2306-2327
0.001
1
6mer
1455-1481
0.000
Not Conserved
6mer
2778-2800
0.000
Not Conserved
H19
hsa-miR-29c-3p
0.994

Gene Details
Chromosome: 11
Transcript: ENST00000414790
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
746-765
0.091
6
6mer
2238-2259
0.003
1
H19
hsa-miR-29c-3p
0.993

Gene Details
Chromosome: 11
Transcript: ENST00000439725
Biotype: lincRNA
Gene id: ENSG00000130600
Gene Name: H19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-29c-3p
Sequence: uagcaccauuugaaaucgguua
MirBase ID: MIMAT0000681
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
733-752
0.093
6
Funded by: