Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-30b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
24232-24240
0.012
2
8mer
188466-188483
0.011
2
8mer
203335-203360
0.010
2
8mer
29763-29787
0.008
2
9mer
178660-178683
0.007
2
7mer
119353-119372
0.007
10
9mer
226014-226027
0.007
2
8mer
128647-128673
0.007
4
8mer
134899-134912
0.007
2
7mer
1193-1211
0.006
4
7mer
156651-156671
0.006
2
8mer
157465-157490
0.006
1
7mer
179903-179920
0.006
2
7mer
72008-72033
0.005
1
8mer
264265-264282
0.005
2
9mer
139825-139839
0.005
2
7mer
201907-201931
0.005
Not Conserved
8mer
252409-252420
0.005
4
7mer
63582-63594
0.005
2
7mer
69534-69557
0.005
2
7mer
134413-134425
0.004
2
8mer
91535-91547
0.004
1
7mer
156798-156822
0.004
2
7mer
41599-41618
0.004
2
7mer
174191-174215
0.004
2
7mer
44539-44557
0.004
2
8mer
31030-31038
0.004
2
9mer
169430-169444
0.004
Not Conserved
8mer
74943-74963
0.004
6
7mer
148835-148845
0.004
2
7mer
259685-259698
0.004
4
7mer
253974-253999
0.004
2
7mer
252612-252629
0.004
2
7mer
48221-48239
0.003
3
7mer
95556-95581
0.003
2
7mer
131301-131325
0.003
2
7mer
64224-64248
0.003
2
7mer
244157-244180
0.003
2
7mer
152091-152103
0.003
1
7mer
110380-110399
0.003
2
7mer
104879-104903
0.003
2
7mer
245045-245064
0.003
1
7mer
247227-247250
0.003
1
7mer
17882-17902
0.003
2
9mer
133747-133761
0.003
1
7mer
51219-51237
0.003
2
7mer
133201-133225
0.003
2
7mer
229001-229025
0.003
1
7mer
65974-65998
0.003
1
7mer
71507-71532
0.003
2
7mer
237509-237532
0.003
3
7mer
199338-199357
0.003
2
7mer
112674-112699
0.003
1
6mer
146-169
0.003
2
7mer
177123-177148
0.003
2
7mer
142172-142185
0.003
2
7mer
120225-120248
0.003
5
7mer
170149-170173
0.003
2
7mer
105614-105639
0.003
2
7mer
247552-247575
0.003
1
7mer
207245-207267
0.003
5
7mer
219195-219220
0.003
1
7mer
4655-4668
0.003
3
7mer
115392-115413
0.003
1
8mer
36917-36942
0.003
1
8mer
90471-90489
0.003
2
7mer
252747-252765
0.003
2
7mer
164660-164683
0.003
1
7mer
129931-129956
0.003
1
7mer
218490-218514
0.003
2
7mer
127841-127864
0.003
1
7mer
70683-70700
0.003
2
8mer
80573-80594
0.003
1
7mer
227373-227397
0.003
2
7mer
5880-5897
0.003
2
7mer
158364-158389
0.002
2
7mer
169584-169607
0.002
1
7mer
21051-21065
0.002
2
7mer
44671-44683
0.002
2
7mer
244748-244771
0.002
1
7mer
261256-261281
0.002
2
7mer
133903-133927
0.002
2
7mer
138457-138469
0.002
1
8mer
158208-158222
0.002
2
7mer
137981-138006
0.002
1
7mer
176265-176288
0.002
2
7mer
95017-95041
0.002
2
8mer
100786-100798
0.002
Not Conserved
7mer
18065-18089
0.002
1
7mer
138125-138149
0.002
1
6mer
163513-163530
0.002
5
7mer
65675-65687
0.002
1
7mer
136596-136620
0.002
2
6mer
20820-20834
0.002
7
7mer
115513-115536
0.002
2
7mer
63713-63732
0.002
2
7mer
228718-228743
0.002
1
7mer
42891-42903
0.002
1
7mer
130068-130092
0.002
2
6mer
257775-257794
0.002
6
6mer
64837-64850
0.002
2
7mer
137639-137657
0.002
2
7mer
259428-259440
0.002
1
7mer
263750-263762
0.002
Not Conserved
7mer
52880-52899
0.002
2
7mer
226634-226660
0.002
2
7mer
222126-222145
0.002
3
7mer
206405-206416
0.002
2
7mer
65810-65835
0.002
1
6mer
113971-113992
0.002
4
6mer
134101-134128
0.002
6
7mer
161008-161032
0.002
2
7mer
27339-27364
0.002
1
6mer
20609-20627
0.002
10
6mer
7429-7454
0.002
4
7mer
126001-126026
0.002
1
6mer
266552-266574
0.002
2
8mer
80704-80729
0.002
1
6mer
125661-125670
0.002
2
6mer
29352-29379
0.002
2
8mer+wobble
34391-34414
0.002
2
7mer
194392-194417
0.002
2
7mer
255511-255535
0.002
2
7mer
157600-157624
0.002
2
6mer
163723-163736
0.002
4
7mer
108804-108829
0.002
1
8mer
77636-77650
0.002
1
8mer
91367-91381
0.002
1
6mer
181573-181586
0.002
3
7mer
205957-205981
0.002
1
7mer
105741-105766
0.002
2
7mer
18200-18212
0.002
1
7mer
209945-209965
0.002
2
6mer
121799-121819
0.002
2
7mer
93287-93308
0.002
2
7mer
166938-166952
0.002
2
7mer
126136-126160
0.002
2
6mer
122654-122676
0.002
2
7mer
41743-41767
0.002
2
7mer
70825-70848
0.002
1
7mer
119517-119539
0.002
7
7mer
43014-43039
0.002
1
7mer
204350-204371
0.002
1
8mer
127673-127687
0.002
1
6mer
13242-13262
0.002
7
7mer
205451-205477
0.002
1
6mer
164276-164294
0.002
2
7mer
183943-183966
0.002
1
6mer
241882-241898
0.002
2
6mer
13607-13622
0.002
1
6mer
71195-71210
0.002
2
6mer
155071-155090
0.002
2
7mer
112809-112832
0.002
1
6mer
135646-135672
0.002
4
6mer
217405-217424
0.002
5
8mer
80549-80563
0.002
1
6mer
129048-129062
0.002
5
8mer
110059-110073
0.002
2
6mer
92167-92180
0.002
3
7mer
178824-178836
0.002
1
6mer
190648-190669
0.002
1
8mer
51225-51251
0.002
1
6mer
119130-119149
0.002
8
6mer
208558-208581
0.002
7
6mer
186246-186265
0.002
3
6mer
79083-79105
0.002
4
6mer
209766-209785
0.002
4
7mer
138798-138821
0.002
1
6mer
123353-123377
0.002
5
6mer
155634-155656
0.002
1
6mer
7081-7105
0.002
4
6mer
217031-217055
0.002
3
7mer
243802-243826
0.002
2
6mer
99228-99253
0.002
2
6mer
239051-239073
0.001
2
6mer
165762-165781
0.001
4
6mer
265246-265264
0.001
5
6mer
51858-51881
0.001
3
6mer
188069-188096
0.001
2
7mer
255366-255380
0.001
1
6mer
48508-48529
0.001
3
6mer
56324-56344
0.001
2
6mer
92988-93013
0.001
Not Conserved
6mer
60213-60235
0.001
2
7mer
92803-92818
0.001
1
6mer
37455-37477
0.001
2
6mer
111538-111559
0.001
1
6mer
106737-106743
0.001
2
6mer
212685-212700
0.001
2
7mer
237611-237635
0.001
2
7mer
194528-194552
0.001
1
6mer
146379-146401
0.001
2
6mer
209261-209288
0.001
2
6mer
9404-9420
0.001
3
6mer
192468-192490
0.001
1
6mer
264522-264544
0.001
2
6mer
180971-180993
0.001
2
7mer
93340-93357
0.001
2
6mer
116413-116433
0.001
3
6mer
34840-34859
0.001
4
6mer
262088-262110
0.001
2
6mer
15220-15242
0.001
2
6mer
260301-260323
0.001
2
6mer
38238-38260
0.001
1
6mer
73045-73067
0.001
1
6mer
117721-117743
0.001
3
6mer
102878-102900
0.001
2
6mer
26610-26627
0.001
1
6mer
58682-58703
0.001
2
6mer
140422-140444
0.001
2
6mer
225063-225085
0.001
2
7mer
178837-178849
0.001
2
6mer
14846-14868
0.001
2
6mer
4346-4368
0.001
1
6mer
253213-253235
0.001
1
6mer
263093-263115
0.001
1
6mer
5458-5466
0.001
1
6mer
236467-236489
0.001
2
6mer
255820-255838
0.001
2
6mer
180303-180324
0.001
2
6mer
223509-223531
0.001
2
6mer
8813-8835
0.001
2
6mer
214821-214842
0.001
2
6mer
115696-115714
0.001
2
7mer
263750-263775
0.001
1
6mer
234641-234663
0.001
2
7mer
205207-205234
0.001
2
6mer
232245-232267
0.001
1
6mer
67540-67562
0.001
2
7mer
178689-178701
0.001
1
7mer
152091-152116
0.001
2
6mer
122218-122245
0.001
2
6mer
230203-230225
0.001
1
6mer
170788-170802
0.001
1
6mer
85545-85568
0.001
2
6mer
167846-167865
0.001
2
7mer
27475-27498
0.001
1
6mer
114813-114833
0.001
3
6mer
247880-247902
0.001
1
6mer
90295-90320
0.001
2
6mer
162499-162526
0.001
1
6mer
221673-221695
0.001
2
6mer
102067-102091
0.001
2
6mer
231036-231058
0.001
1
6mer
43997-44020
0.001
2
7mer
133768-133792
0.001
2
7mer
91387-91412
0.001
1
6mer
177410-177434
0.001
1
6mer
231645-231666
0.001
1
6mer
251965-251985
0.001
1
7mer
24662-24674
0.001
2
6mer
188876-188898
0.001
2
6mer
135097-135124
0.001
2
6mer
36214-36237
0.001
1
6mer
24642-24661
0.001
1
6mer
187096-187118
0.001
1
6mer
45032-45054
0.001
1
6mer
77165-77187
0.001
1
6mer
237863-237885
0.001
2
6mer
194923-194941
0.001
3
6mer
54708-54731
0.001
1
6mer
67962-67984
0.001
2
7mer
63582-63607
0.001
2
7mer
44671-44696
0.001
1
6mer
261763-261785
0.001
1
6mer
251538-251565
0.001
1
6mer
256637-256660
0.001
1
6mer
147780-147802
0.001
2
6mer
27849-27873
0.001
1
7mer
117840-117857
0.001
1
6mer
248018-248040
0.001
1
6mer
264659-264678
0.001
2
6mer
46997-47023
0.001
3
6mer
77761-77783
0.001
1
6mer
51532-51547
0.001
2
6mer
154124-154142
0.001
1
6mer
121996-122016
0.001
Not Conserved
6mer
94217-94237
0.001
3
6mer
174435-174457
0.001
1
6mer
21859-21879
0.001
6
6mer
224526-224548
0.001
2
7mer
18201-18225
0.001
2
7mer
222212-222238
0.001
3
6mer
193315-193342
0.001
Not Conserved
7mer
93438-93459
0.001
2
6mer
14589-14611
0.001
2
6mer
96842-96862
0.001
3
6mer
162638-162660
0.001
1
6mer
98707-98731
0.001
3
6mer
234409-234431
0.001
2
6mer
68997-69019
0.001
2
6mer
202777-202799
0.001
Not Conserved
6mer
30226-30248
0.001
1
6mer
14006-14028
0.001
1
6mer
83961-83982
0.001
2
6mer
14283-14305
0.001
1
6mer
83755-83771
0.001
2
7mer
169916-169935
0.001
Not Conserved
6mer
253382-253404
0.001
2
6mer
53346-53362
0.001
4
6mer
88895-88911
0.001
2
6mer
249429-249451
0.001
1
6mer
73503-73525
0.001
2
6mer
250892-250914
0.001
1
6mer
225622-225644
0.001
2
6mer
11574-11596
0.001
2
6mer
85336-85355
0.001
2
7mer
77656-77681
0.001
1
6mer
213271-213293
0.001
Not Conserved
6mer
197324-197348
0.001
2
6mer
137478-137503
0.001
2
6mer
21464-21482
0.001
2
6mer
137143-137155
0.001
2
7mer
217565-217590
0.001
1
6mer
177547-177569
0.001
2
6mer
221832-221856
0.001
2
7mer
226027-226044
0.001
2
6mer
262228-262247
0.001
2
6mer
260593-260615
0.001
2
6mer
30622-30641
0.001
2
6mer
115024-115046
0.001
1
6mer
153495-153517
0.001
1
6mer
121262-121289
0.001
1
7mer
77791-77815
0.001
1
6mer
181141-181163
0.001
Not Conserved
7mer
134413-134438
0.001
2
6mer
193455-193475
0.001
Not Conserved
6mer
187230-187252
0.001
1
6mer
93387-93406
0.001
2
6mer
127945-127966
0.001
2
6mer
256773-256795
0.001
1
6mer
206102-206124
0.001
1
6mer
218583-218608
0.001
2
6mer
256893-256911
0.001
Not Conserved
6mer
38952-38971
0.001
1
6mer
93567-93585
0.001
2
6mer
239184-239206
0.001
2
6mer
231784-231803
0.001
1
6mer
170915-170937
0.001
2
6mer
253511-253538
0.001
2
7mer
39005-39026
0.001
1
6mer
38372-38394
0.001
2
6mer
29474-29488
0.001
1
6mer
146515-146537
0.001
1
6mer
51660-51682
0.001
2
6mer
64960-64984
0.001
2
6mer
21686-21710
0.001
1
6mer
236596-236618
0.001
2
6mer
192601-192623
0.001
1
6mer
73183-73205
0.001
1
6mer
212813-212835
0.001
2
6mer
260436-260458
0.001
2
6mer
109625-109644
0.001
2
6mer
229144-229171
0.001
1
6mer
37587-37610
0.001
1
6mer
84447-84466
0.001
2
6mer
85679-85701
0.001
2
6mer
65097-65119
0.001
1
6mer
249562-249584
0.001
1
7mer
138588-138608
0.001
1
6mer
252052-252074
0.001
2
6mer
38985-39004
0.001
2
6mer
243750-243776
0.001
Not Conserved
6mer
8947-8969
0.001
1
6mer
79730-79750
0.001
1
6mer
142846-142858
0.001
3
6mer
263232-263254
0.001
1
6mer
184012-184034
0.001
1
6mer
237998-238020
0.001
1
6mer
226058-226076
0.001
2
6mer
14418-14440
0.001
1
6mer
202909-202933
0.001
Not Conserved
6mer
265347-265368
0.001
3
6mer
215872-215891
0.001
2
6mer
138678-138689
0.001
1
6mer
229282-229304
0.001
1
6mer
114892-114911
0.001
Not Conserved
6mer
45160-45187
0.001
2
6mer
181277-181299
0.001
Not Conserved
6mer
259474-259496
0.001
2
7mer
41605-41631
0.001
1
6mer
234836-234858
0.001
1
7mer
21526-21550
0.001
3
6mer
234703-234725
0.000
1
6mer
206240-206259
0.000
Not Conserved
6mer
213408-213427
0.000
1
6mer
178867-178892
0.000
1
6mer
154131-154152
0.000
1
6mer
66014-66035
0.000
1
LOC100190986
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 16
Transcript: NR_024456.1
Biotype: sense
Gene id: NR_024456.1 (gene)
Gene Name: LOC100190986
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2197-2222
0.060
1
7mer
2331-2355
0.053
1
7mer
549-574
0.038
1
8mer
716-730
0.029
1
7mer
1693-1705
0.021
1
6mer
128-147
0.015
1
6mer
259-281
0.013
1
XLOC_000191
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: chr1
Transcript: TCONS_00000939
Biotype: transcript isomorph
Gene id: XLOC_000191
Gene Name: XLOC_000191
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
23-46
0.073
2
7mer
152-177
0.056
2
7mer
437-449
0.055
2
6mer
1803-1825
0.014
2
6mer
1938-1960
0.013
2
6mer
751-769
0.011
2
6mer
507-531
0.003
1
RP11-34P13.13
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000484859
Biotype: antisense
Gene id: ENSG00000241860
Gene Name: RP11-34P13.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4589-4614
0.067
2
7mer
3989-4013
0.030
2
9mer
2984-2998
0.020
2
7mer
2083-2098
0.016
2
7mer
1813-1831
0.015
2
6mer
4120-4145
0.013
2
7mer
248-260
0.012
1
7mer
1588-1602
0.009
2
9mer
2522-2548
0.008
1
6mer
384-402
0.005
1
6mer
2679-2697
0.005
2
6mer
3275-3302
0.005
2
KCNQ1OT1
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
39393-39411
0.016
1
8mer
55318-55339
0.010
2
9mer
79071-79098
0.009
2
7mer
91106-91120
0.005
Not Conserved
7mer
77209-77230
0.004
2
7mer
37561-37578
0.004
1
7mer
85314-85334
0.004
2
7mer
62236-62249
0.004
1
7mer
56451-56464
0.004
4
8mer
73446-73470
0.004
2
8mer+wobble
18730-18756
0.004
Not Conserved
7mer
36505-36531
0.003
1
9mer
43782-43806
0.003
2
7mer
46218-46235
0.003
3
7mer
82842-82861
0.003
4
8mer
57593-57610
0.003
1
7mer
23749-23761
0.003
1
6mer
429-451
0.003
2
7mer
37039-37060
0.003
1
7mer
77956-77980
0.003
3
6mer
21332-21357
0.003
1
6mer
89834-89845
0.003
4
8mer
84380-84405
0.003
1
6mer
7161-7179
0.002
2
7mer
76414-76425
0.002
2
6mer
61321-61332
0.002
1
7mer
23614-23637
0.002
1
6mer
50033-50046
0.002
1
6mer
44294-44315
0.002
5
7mer
39315-39331
0.002
1
6mer
82622-82638
0.002
3
7mer
31385-31401
0.002
1
6mer
16203-16228
0.002
1
6mer
60627-60651
0.002
2
6mer
63025-63047
0.002
2
6mer
86058-86079
0.002
1
6mer
32226-32230
0.002
1
6mer
2324-2347
0.002
1
6mer
53950-53977
0.002
4
6mer
90927-90942
0.002
1
7mer
62811-62832
0.002
2
6mer
29484-29498
0.002
1
6mer
17509-17531
0.002
2
7mer
55921-55931
0.002
1
6mer
35886-35907
0.002
1
6mer
44616-44641
0.002
2
8mer+mismatch
90180-90199
0.002
2
6mer
90539-90555
0.002
1
7mer
2236-2247
0.001
1
7mer
31978-32003
0.001
1
6mer
68483-68507
0.001
2
6mer
78678-78692
0.001
1
6mer
19210-19234
0.001
2
6mer
18334-18361
0.001
2
6mer
65567-65582
0.001
2
7mer
53596-53618
0.001
1
6mer
27627-27638
0.001
1
6mer
85081-85097
0.001
2
6mer
38987-39003
0.001
1
6mer
58502-58517
0.001
1
6mer
58356-58381
0.001
4
6mer
61027-61042
0.001
2
6mer
63980-63997
0.001
3
6mer
3152-3174
0.001
1
6mer
54248-54268
0.001
5
6mer
12783-12805
0.001
2
6mer
12156-12178
0.001
1
6mer
53251-53270
0.001
2
6mer
6551-6568
0.001
1
6mer
57081-57107
0.001
2
6mer
76025-76038
0.001
2
6mer
23256-23269
0.001
Not Conserved
6mer
82143-82156
0.001
2
6mer
77374-77395
0.001
2
6mer
71832-71846
0.001
2
6mer
59585-59607
0.001
2
6mer
19692-19714
0.001
2
6mer
90068-90095
0.001
2
6mer
31746-31764
0.001
1
6mer
75366-75390
0.001
2
6mer
19772-19791
0.001
2
6mer
71699-71721
0.001
1
6mer
19556-19577
0.001
2
6mer
75921-75931
0.001
2
6mer
3025-3047
0.001
2
6mer
36859-36879
0.001
1
6mer
56119-56143
0.001
1
6mer
12022-12044
0.001
2
6mer
32091-32113
0.001
1
6mer
17375-17394
0.001
2
7mer
82100-82113
0.001
1
7mer
53553-53575
0.001
2
6mer
73439-73454
0.000
2
RP11-206L10.3
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000416385
Biotype: lincRNA
Gene id: ENSG00000235373
Gene Name: RP11-206L10.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4589-4614
0.067
1
7mer
3989-4013
0.028
1
9mer
2984-2998
0.020
1
7mer
2084-2099
0.016
1
7mer
1813-1831
0.015
1
6mer
4120-4145
0.013
1
7mer
1588-1602
0.010
1
7mer
248-260
0.005
Not Conserved
6mer
2679-2697
0.005
1
6mer
3275-3302
0.005
1
9mer
2519-2545
0.003
Not Conserved
6mer
384-402
0.002
Not Conserved
LINC00665
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000590657
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2163-2174
0.042
2
8mer
603-617
0.041
2
7mer
446-470
0.041
2
7mer
1180-1204
0.033
2
6mer
2363-2389
0.015
2
8mer
1711-1728
0.011
1
6mer
55-68
0.008
1
RP11-244B22.11
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000565523
Biotype: lincRNA
Gene id: ENSG00000261800
Gene Name: RP11-244B22.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
419-441
0.061
1
8mer
346-369
0.056
1
7mer
413-434
0.036
1
6mer
550-559
0.017
1
7mer
169-191
0.015
1
6mer
81-97
0.002
Not Conserved
ZNF561-AS1
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000586943
Biotype: retained_intron
Gene id: ENSG00000267106
Gene Name: ZNF561-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
594-617
0.044
1
9mer
1692-1706
0.042
1
7mer
1846-1869
0.037
1
8mer
1343-1360
0.029
1
6mer
408-430
0.011
1
6mer
884-906
0.008
1
6mer
1261-1284
0.007
1
6mer
1711-1724
0.005
1
6mer
1933-1960
0.002
Not Conserved
XLOC_009222
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: chr11
Transcript: TCONS_00019399
Biotype: transcript isomorph
Gene id: XLOC_009222
Gene Name: XLOC_009222
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
6089-6102
0.098
1
9mer
3134-3148
0.026
1
7mer
2713-2729
0.016
1
6mer
5830-5851
0.013
1
6mer
975-993
0.013
1
6mer
3408-3425
0.007
1
7mer
6109-6134
0.005
Not Conserved
6mer
4288-4307
0.005
1
AC006548.28
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
7017-7035
0.014
2
7mer
177-201
0.012
2
8mer
2761-2779
0.007
3
7mer
14752-14767
0.006
5
8mer
74424-74433
0.006
2
9mer
16574-16589
0.005
2
8mer
44581-44607
0.005
1
8mer
7456-7474
0.004
2
8mer
63312-63324
0.004
2
7mer
2384-2405
0.004
3
8mer
7725-7748
0.003
4
6mer
20261-20275
0.003
2
7mer
49282-49295
0.003
Not Conserved
7mer
52149-52175
0.003
Not Conserved
7mer
8871-8894
0.002
Not Conserved
6mer
24138-24164
0.002
3
6mer
24382-24400
0.002
2
6mer
1893-1907
0.002
1
6mer
8119-8135
0.002
3
7mer
82352-82375
0.002
2
6mer
35302-35326
0.002
2
8mer
57518-57540
0.002
1
7mer
72136-72157
0.002
Not Conserved
6mer
30150-30163
0.002
2
7mer
35883-35905
0.002
2
6mer
732-743
0.002
2
6mer
33643-33661
0.002
1
7mer
4241-4259
0.002
1
6mer
79264-79288
0.002
Not Conserved
6mer
27490-27510
0.002
2
6mer
34524-34541
0.002
2
6mer
50183-50199
0.002
Not Conserved
6mer
14144-14167
0.002
2
7mer
20091-20109
0.001
3
7mer
10406-10425
0.001
1
6mer
37205-37227
0.001
2
6mer
42769-42787
0.001
1
6mer
12109-12124
0.001
2
7mer
19906-19927
0.001
2
6mer
2805-2829
0.001
3
7mer
71562-71581
0.001
1
6mer
30473-30494
0.001
2
6mer
4867-4890
0.001
2
6mer
53145-53162
0.001
Not Conserved
6mer
58433-58446
0.001
2
6mer
36050-36074
0.001
2
6mer
35013-35026
0.001
2
7mer
71999-72022
0.001
Not Conserved
7mer
21002-21027
0.001
2
6mer
77024-77047
0.001
1
6mer
48331-48342
0.001
Not Conserved
6mer
59708-59724
0.001
1
6mer
27929-27953
0.001
2
7mer
59648-59659
0.001
2
6mer
36593-36616
0.001
2
6mer
25704-25716
0.001
1
6mer
25456-25476
0.001
2
6mer
28770-28789
0.001
2
6mer
24740-24763
0.001
2
6mer
38014-38033
0.001
2
6mer
81785-81805
0.001
1
6mer
10592-10613
0.001
1
6mer
12398-12411
0.001
2
6mer
39421-39440
0.001
2
6mer
53577-53601
0.001
Not Conserved
6mer
9538-9558
0.001
2
6mer
65107-65127
0.001
2
6mer
61985-62004
0.001
2
6mer
66889-66911
0.001
1
6mer
64449-64473
0.001
1
6mer
6155-6182
0.001
2
6mer
10161-10179
0.001
1
6mer
12814-12829
0.001
2
8mer
12665-12682
0.001
Not Conserved
6mer
19445-19470
0.001
2
8mer
57471-57483
0.001
2
6mer
62952-62966
0.001
2
6mer
16164-16187
0.001
4
6mer
51944-51961
0.001
Not Conserved
6mer
1857-1870
0.001
2
6mer
81635-81657
0.001
2
6mer
21015-21034
0.001
1
6mer
5237-5258
0.001
2
7mer
57425-57436
0.001
1
6mer
77864-77883
0.001
1
6mer
54415-54434
0.001
Not Conserved
6mer
45506-45518
0.001
Not Conserved
6mer
60546-60571
0.001
Not Conserved
7mer
13530-13545
0.001
1
6mer
58117-58139
0.001
2
6mer
8067-8082
0.000
2
6mer
10379-10402
0.000
2
MIR4534
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
51182-51204
0.006
2
8mer
4938-4956
0.005
2
7mer
41255-41269
0.005
2
7mer
25157-25182
0.004
9
8mer
12816-12828
0.004
1
7mer
1683-1708
0.004
2
7mer
43002-43027
0.003
2
8mer
53261-53275
0.003
2
8mer
30505-30519
0.003
2
8mer
11532-11546
0.003
2
7mer
16890-16915
0.003
Not Conserved
7mer
1995-2020
0.003
2
7mer
7838-7863
0.003
2
7mer
27937-27956
0.003
2
8mer
54101-54115
0.003
1
7mer
33015-33034
0.003
1
8mer
15038-15064
0.003
2
7mer
46528-46553
0.003
2
7mer
29205-29228
0.003
2
9mer
2167-2183
0.003
1
7mer
2932-2951
0.003
1
7mer
11688-11712
0.002
2
7mer
50439-50457
0.002
4
7mer
30982-31006
0.002
2
7mer
12286-12309
0.002
1
7mer
12418-12441
0.002
1
7mer
26237-26261
0.002
3
8mer
32436-32458
0.002
1
7mer
44123-44137
0.002
2
6mer
53570-53588
0.002
2
7mer
6186-6209
0.002
1
7mer
12734-12757
0.002
1
7mer
14586-14598
0.002
2
7mer
3564-3589
0.002
Not Conserved
7mer
10079-10102
0.002
1
7mer
44282-44307
0.002
2
6mer
54115-54133
0.002
1
7mer
44404-44424
0.002
2
7mer
7960-7984
0.002
1
6mer
32110-32119
0.002
3
7mer
3698-3723
0.002
1
6mer
18887-18899
0.002
2
7mer
12601-12622
0.002
Not Conserved
6mer
14874-14899
0.001
2
8mer
2939-2965
0.001
1
6mer
50707-50719
0.001
4
7mer
32373-32386
0.001
1
6mer
6911-6938
0.001
2
6mer
42654-42681
0.001
1
6mer
15609-15636
0.001
2
6mer
13603-13630
0.001
1
7mer
46389-46414
0.001
2
6mer
41960-41984
0.001
3
6mer
48454-48477
0.001
2
6mer
28683-28702
0.001
2
6mer
45367-45389
0.001
1
6mer
40163-40185
0.001
1
6mer
18150-18172
0.001
1
6mer
47350-47372
0.001
2
6mer
12939-12963
0.001
1
6mer
31449-31470
0.001
2
7mer
2189-2201
0.001
1
6mer
2585-2612
0.001
1
6mer
15454-15469
0.001
2
6mer
39054-39078
0.001
2
6mer
39696-39723
0.001
1
6mer
27621-27640
0.001
2
7mer
30525-30550
0.001
2
6mer
34425-34448
0.001
2
8mer
11552-11578
0.001
2
6mer
13136-13156
0.001
1
6mer
36682-36699
0.001
1
6mer
34152-34170
0.001
2
6mer
21980-22002
0.001
1
6mer
6429-6451
0.001
1
6mer
21666-21693
0.001
1
6mer
48593-48608
0.001
2
6mer
51633-51654
0.001
2
6mer
8489-8515
0.001
3
6mer
46717-46734
0.001
1
6mer
35927-35948
0.001
4
6mer
11897-11915
0.001
2
6mer
49419-49441
0.001
1
6mer
47507-47534
0.001
2
6mer
11184-11199
0.001
1
6mer
8591-8615
0.001
2
6mer
7051-7073
0.001
1
6mer
44543-44557
0.001
Not Conserved
6mer
21806-21828
0.001
2
6mer
27735-27757
0.001
2
6mer
41375-41401
0.001
2
6mer
45501-45523
0.001
1
6mer
39842-39864
0.001
1
6mer
7986-8013
0.001
2
6mer
50868-50895
0.001
3
7mer
50769-50787
0.001
1
6mer
22122-22141
0.001
1
6mer
2284-2306
0.001
1
6mer
13738-13765
0.000
Not Conserved
6mer
20559-20576
0.000
Not Conserved
6mer
2029-2050
0.000
1
XLOC_012002
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: chr16
Transcript: TCONS_00024719
Biotype: transcript isomorph
Gene id: XLOC_012002
Gene Name: XLOC_012002
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
15-34
0.078
6
7mer
327-349
0.047
8
8mer
337-353
0.044
3
XLOC_014174
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: chr22
Transcript: TCONS_00029531
Biotype: transcript isomorph
Gene id: XLOC_014174
Gene Name: XLOC_014174
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
875-887
0.020
Not Conserved
7mer
899-911
0.016
Not Conserved
7mer
184-196
0.015
Not Conserved
7mer
745-757
0.015
Not Conserved
8mer
72-85
0.012
Not Conserved
8mer
583-596
0.011
Not Conserved
7mer
651-675
0.009
Not Conserved
7mer
915-938
0.009
Not Conserved
7mer
828-840
0.008
Not Conserved
7mer
721-733
0.008
Not Conserved
7mer
770-781
0.007
Not Conserved
7mer
288-309
0.007
Not Conserved
7mer
548-560
0.005
Not Conserved
7mer
513-525
0.005
Not Conserved
6mer
974-986
0.005
Not Conserved
7mer
651-663
0.004
Not Conserved
7mer
493-513
0.004
Not Conserved
6mer
37-49
0.003
Not Conserved
6mer
230-242
0.003
Not Conserved
6mer
481-493
0.002
Not Conserved
RP11-46H11.3
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 12
Transcript: ENST00000503695
Biotype: lincRNA
Gene id: ENSG00000250790
Gene Name: RP11-46H11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
458-483
0.025
1
8mer
1585-1601
0.023
1
7mer
2049-2074
0.022
1
7mer
368-392
0.022
1
9mer
1895-1909
0.021
1
7mer
1744-1768
0.017
1
6mer
340-360
0.016
1
7mer
1915-1940
0.011
1
6mer
971-993
0.007
1
6mer
1105-1127
0.004
1
RP3-323A16.1
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
139-164
0.012
2
9mer
119-133
0.011
1
7mer
443-467
0.007
2
8mer
37066-37088
0.007
8
7mer
1676-1691
0.006
5
8mer
42847-42871
0.006
2
8mer
36930-36949
0.006
2
7mer
37639-37651
0.006
2
9mer
45375-45396
0.006
2
6mer
53897-53923
0.004
1
7mer
48276-48294
0.003
2
7mer
8132-8145
0.003
1
7mer
43690-43713
0.003
1
7mer
882-905
0.003
1
7mer
50431-50447
0.003
2
6mer
42151-42169
0.003
3
7mer
15894-15903
0.003
3
8mer
38166-38186
0.003
1
6mer
32905-32923
0.002
1
7mer
5351-5372
0.002
1
7mer
21759-21782
0.002
2
7mer
31382-31403
0.002
1
7mer
4750-4776
0.002
1
7mer
48804-48829
0.002
Not Conserved
6mer
39756-39774
0.002
2
7mer
13372-13386
0.002
2
6mer
39302-39319
0.002
3
6mer
37884-37901
0.002
4
6mer
33129-33153
0.002
2
6mer
12813-12828
0.002
2
7mer
1118-1143
0.002
1
6mer
31715-31735
0.001
2
8mer+wobble
24070-24090
0.001
Not Conserved
6mer
7228-7245
0.001
1
6mer
19945-19963
0.001
2
6mer
924-938
0.001
1
6mer
19801-19813
0.001
3
6mer
47058-47077
0.001
2
6mer
27985-28007
0.001
2
7mer
47146-47171
0.001
2
6mer
21919-21931
0.001
2
6mer
2995-3017
0.001
2
6mer
51290-51316
0.001
1
6mer
3887-3908
0.001
2
7mer
19027-19038
0.001
1
6mer
19659-19671
0.001
Not Conserved
6mer
47941-47963
0.001
2
6mer
39024-39040
0.001
2
6mer
36590-36612
0.001
1
6mer
4990-5007
0.001
1
6mer
44914-44933
0.001
2
7mer
11343-11363
0.001
2
6mer
18210-18232
0.001
1
6mer
32276-32299
0.001
1
6mer
4060-4084
0.001
Not Conserved
6mer
10369-10387
0.001
2
6mer
12514-12527
0.001
2
6mer
16940-16955
0.001
3
6mer
28375-28394
0.001
1
7mer
5397-5412
0.001
1
8mer+mismatch
21604-21618
0.001
Not Conserved
6mer
36718-36740
0.001
2
6mer
18344-18366
0.001
1
6mer
48475-48490
0.001
1
6mer
3125-3147
0.001
2
7mer
21624-21649
0.001
Not Conserved
6mer
9873-9896
0.001
1
7mer
49676-49703
0.001
1
6mer
48076-48095
0.001
1
6mer
12943-12964
0.001
2
7mer
21919-21944
0.001
Not Conserved
RP13-580B18.4
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: 7
Transcript: ENST00000624628
Biotype: lincRNA
Gene id: ENSG00000279072
Gene Name: RP13-580B18.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
342-365
0.011
1
9mer
23962-23982
0.009
Not Conserved
7mer
23944-23962
0.007
Not Conserved
7mer
23065-23084
0.006
1
7mer
20210-20227
0.005
1
7mer
23931-23956
0.005
Not Conserved
8mer
23574-23588
0.005
1
8mer
23765-23778
0.005
Not Conserved
8mer
19449-19463
0.003
1
7mer
23501-23512
0.003
1
7mer
10642-10661
0.003
1
7mer
915-934
0.003
Not Conserved
8mer
22261-22280
0.002
1
6mer
23365-23383
0.002
1
7mer
6918-6937
0.002
Not Conserved
7mer
16213-16232
0.002
Not Conserved
7mer
19000-19020
0.002
1
7mer
5128-5147
0.002
Not Conserved
7mer
12624-12643
0.002
Not Conserved
8mer
12362-12382
0.002
Not Conserved
7mer
19134-19157
0.002
1
8mer
10380-10400
0.002
1
7mer
8804-8823
0.002
Not Conserved
7mer
3386-3405
0.002
Not Conserved
7mer
14471-14490
0.002
Not Conserved
7mer
18051-18070
0.002
Not Conserved
7mer
3843-3866
0.002
1
8mer
20744-20764
0.002
1
7mer
18512-18535
0.002
1
7mer
1457-1474
0.002
Not Conserved
8mer
4866-4886
0.002
Not Conserved
8mer
14211-14231
0.002
Not Conserved
7mer
11099-11122
0.002
Not Conserved
7mer
7375-7398
0.002
Not Conserved
7mer
16670-16693
0.002
Not Conserved
8mer
22964-22982
0.002
Not Conserved
7mer
2089-2112
0.002
Not Conserved
7mer
5585-5608
0.002
Not Conserved
7mer
14928-14951
0.002
Not Conserved
8mer
15951-15971
0.001
Not Conserved
8mer
6656-6676
0.001
Not Conserved
7mer
13081-13104
0.001
Not Conserved
7mer
9261-9284
0.001
Not Conserved
8mer
20609-20633
0.001
1
8mer
3124-3144
0.001
Not Conserved
8mer
2892-2911
0.001
Not Conserved
8mer
17789-17809
0.001
Not Conserved
8mer
8375-8395
0.001
Not Conserved
6mer
21984-22007
0.001
Not Conserved
7mer
9052-9060
0.001
Not Conserved
8mer
14033-14053
0.001
Not Conserved
8mer
17554-17574
0.001
Not Conserved
8mer
10213-10233
0.001
Not Conserved
8mer
4699-4719
0.001
Not Conserved
8mer
12195-12215
0.001
Not Conserved
8mer
15784-15804
0.001
Not Conserved
8mer
6489-6511
0.001
Not Conserved
6mer
4199-4212
0.001
Not Conserved
7mer
21843-21853
0.001
Not Conserved
7mer
2425-2439
0.001
Not Conserved
6mer
1197-1212
0.001
Not Conserved
8mer
12127-12146
0.001
Not Conserved
8mer
13965-13984
0.001
Not Conserved
8mer
8307-8326
0.001
Not Conserved
8mer
10145-10164
0.001
Not Conserved
8mer
15716-15735
0.001
Not Conserved
8mer
6421-6440
0.001
Not Conserved
6mer
1865-1878
0.001
Not Conserved
6mer
5329-5344
0.001
Not Conserved
8mer
4631-4650
0.001
Not Conserved
8mer
5548-5558
0.001
Not Conserved
6mer
22805-22825
0.001
Not Conserved
6mer
22697-22724
0.001
Not Conserved
6mer
21749-21767
0.000
Not Conserved
XLOC_006242
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: chr7
Transcript: TCONS_00014209
Biotype: transcript isomorph
Gene id: XLOC_006242
Gene Name: XLOC_006242
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
311-336
0.053
2
7mer
1921-1942
0.048
2
7mer
150-166
0.023
2
7mer
826-853
0.006
1
6mer
2207-2227
0.005
1
7mer
2253-2278
0.005
Not Conserved
6mer
1396-1414
0.004
1
6mer
1403-1427
0.002
1
XLOC_007118
hsa-miR-30b-3p
1.000

Gene Details
Chromosome: chr8
Transcript: TCONS_00015037
Biotype: transcript isomorph
Gene id: XLOC_007118
Gene Name: XLOC_007118
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-30b-3p
Sequence: cugggagguggauguuuacuuc
MirBase ID: MIMAT0004589
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
474-494
0.026
1
8mer
3906-3922
0.016
1
7mer
3753-3774
0.014
1
8mer
3603-3620
0.014
1
8mer
719-740
0.014
1
8mer
866-886
0.013
1
7mer
275-292
0.012
1
7mer
2994-3015
0.009
1
8mer
3460-3477
0.008
1
8mer
3507-3524
0.007
1
8mer
2874-2891
0.004
1
8mer
2827-2844
0.003
1
6mer