Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-3159

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-3159
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
37996-38011
0.014
5
7mer
81631-81657
0.008
10
7mer
190869-190883
0.007
3
7mer
9779-9794
0.007
6
7mer
191695-191700
0.006
2
7mer
176307-176323
0.006
2
7mer
49860-49886
0.006
4
7mer
108498-108515
0.005
2
7mer
163254-163268
0.005
4
7mer
198517-198539
0.005
3
7mer
30077-30098
0.005
2
7mer
46440-46458
0.005
2
7mer
145716-145728
0.004
2
7mer
89523-89541
0.004
1
9mer
60811-60831
0.004
2
7mer
11179-11197
0.004
2
9mer
155498-155524
0.004
2
7mer
43006-43022
0.004
2
7mer
206393-206398
0.004
1
7mer
92444-92468
0.004
2
7mer
224756-224772
0.004
2
7mer
51841-51855
0.004
2
7mer
251814-251840
0.004
1
8mer
63574-63590
0.004
2
8mer
129924-129939
0.003
2
7mer
113413-113429
0.003
2
7mer
10917-10937
0.003
4
6mer
149994-150005
0.003
10
9mer
230060-230080
0.003
1
9mer
44948-44968
0.003
1
6mer
254585-254611
0.003
6
7mer
51886-51906
0.003
3
7mer
63201-63216
0.003
Not Conserved
6mer
47235-47239
0.003
5
7mer
206068-206085
0.003
1
6mer
266747-266769
0.003
3
6mer
195095-195110
0.003
5
7mer
226736-226757
0.002
3
6mer
2486-2509
0.002
7
6mer
9320-9346
0.002
5
7mer
117323-117345
0.002
3
9mer
67829-67849
0.002
1
6mer
137088-137103
0.002
1
8mer
44666-44679
0.002
2
9mer
14152-14172
0.002
2
6mer
16908-16933
0.002
4
7mer
6025-6045
0.002
Not Conserved
8mer+wobble
138790-138804
0.002
1
9mer
121572-121589
0.002
1
8mer
152074-152099
0.002
Not Conserved
6mer
231574-231590
0.002
1
7mer
176728-176745
0.002
1
6mer
62608-62630
0.002
2
6mer
56581-56606
0.002
2
6mer
171863-171884
0.002
1
6mer
141708-141732
0.002
2
6mer
12410-12430
0.002
1
6mer
80414-80433
0.002
1
6mer
102318-102345
0.002
3
6mer
76824-76849
0.002
2
6mer
194249-194267
0.002
2
6mer
107915-107934
0.002
1
6mer
150612-150639
0.002
2
6mer
42672-42695
0.002
2
6mer
223240-223256
0.002
2
6mer
129260-129274
0.002
2
6mer
199200-199216
0.001
3
6mer
85486-85490
0.001
2
6mer
33022-33043
0.001
1
6mer
144292-144312
0.001
5
6mer
133528-133548
0.001
Not Conserved
6mer
17343-17352
0.001
2
8mer+wobble
235071-235093
0.001
2
6mer
30354-30377
0.001
3
6mer
174186-174198
0.001
2
6mer
172872-172899
0.001
Not Conserved
6mer
145444-145466
0.001
2
6mer
38850-38870
0.001
2
6mer
34370-34389
0.001
1
6mer
252612-252625
0.001
2
6mer
207816-207843
0.001
2
6mer
253833-253848
0.001
2
6mer
145464-145487
0.001
7
6mer
9566-9577
0.001
2
6mer
41597-41614
0.001
2
6mer
21737-21763
0.001
1
6mer
111255-111272
0.001
3
6mer
61464-61479
0.001
1
6mer
24518-24535
0.001
1
6mer
66867-66877
0.001
4
6mer
48723-48743
0.001
1
6mer
134397-134421
0.001
1
8mer+mismatch
262226-262244
0.001
2
8mer+mismatch
153361-153379
0.001
2
6mer
174832-174846
0.001
1
6mer
136822-136847
0.001
2
6mer
203195-203208
0.001
1
6mer
242615-242640
0.001
1
6mer
48303-48328
0.001
2
6mer
54612-54622
0.001
2
6mer
178819-178832
0.001
1
6mer
252746-252761
0.001
2
6mer
34927-34949
0.001
2
8mer+mismatch
253214-253232
0.001
1
6mer
258348-258366
0.001
2
8mer+mismatch
241043-241061
0.001
2
6mer
64677-64702
0.001
2
8mer+mismatch
238164-238182
0.001
1
8mer+mismatch
15221-15239
0.001
2
8mer+mismatch
77166-77184
0.001
2
6mer
241217-241243
0.001
Not Conserved
8mer+mismatch
146380-146398
0.001
2
6mer
1569-1583
0.001
1
8mer+mismatch
170782-170799
0.001
2
6mer
142136-142153
0.001
1
8mer+mismatch
240908-240926
0.001
2
8mer+mismatch
188877-188895
0.001
2
6mer
139211-139236
0.001
3
6mer
182947-182963
0.001
Not Conserved
8mer+mismatch
252053-252071
0.001
2
8mer+mismatch
225618-225641
0.001
2
8mer+mismatch
234410-234428
0.001
2
8mer+mismatch
234642-234660
0.001
2
8mer+mismatch
60214-60232
0.001
2
8mer+mismatch
11446-11463
0.001
1
8mer+mismatch
14007-14025
0.001
1
8mer+mismatch
38373-38391
0.001
2
8mer+mismatch
64963-64981
0.001
2
8mer+mismatch
260594-260612
0.001
2
8mer+mismatch
237999-238017
0.001
1
6mer
136894-136916
0.001
1
8mer+mismatch
212814-212832
0.001
2
8mer+mismatch
253383-253401
0.001
2
8mer+mismatch
174436-174454
0.001
1
8mer+mismatch
37456-37474
0.001
1
8mer+mismatch
263094-263112
0.001
1
8mer+mismatch
229150-229168
0.001
1
6mer
44537-44553
0.001
2
8mer+mismatch
45401-45419
0.001
2
8mer+mismatch
181142-181160
0.000
Not Conserved
8mer+mismatch
170916-170934
0.000
2
6mer
198536-198552
0.000
1
6mer
44490-44514
0.000
Not Conserved
8mer+mismatch
229283-229301
0.000
1
8mer+mismatch
67963-67981
0.000
2
8mer+mismatch
45033-45051
0.000
1
8mer+mismatch
14284-14302
0.000
1
8mer+mismatch
65098-65116
0.000
1
XLOC_002903
hsa-miR-3159
1.000

Gene Details
Chromosome: chr3
Transcript: TCONS_00006302
Biotype: transcript isomorph
Gene id: XLOC_002903
Gene Name: XLOC_002903
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
665-686
0.211
2
7mer
692-711
0.015
1
XLOC_008328
hsa-miR-3159
1.000

Gene Details
Chromosome: chrY
Transcript: TCONS_00017652
Biotype: transcript isomorph
Gene id: XLOC_008328
Gene Name: XLOC_008328
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Heart Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
568-580
0.084
1
9mer
713-738
0.074
1
7mer
850-870
0.016
1
6mer
924-944
0.010
1
KIAA0087
hsa-miR-3159
1.000

Gene Details
Chromosome: 7
Transcript: NR_022006.1
Biotype: sense
Gene id: NR_022006.1 (gene)
Gene Name: KIAA0087
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
186-211
0.110
13
7mer
4143-4160
0.015
3
9mer
3269-3294
0.011
3
6mer
4158-4176
0.005
1
6mer
3297-3323
0.002
2
6mer
1238-1255
0.001
Not Conserved
RP11-481J2.1
hsa-miR-3159
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000566019
Biotype: antisense
Gene id: ENSG00000261078
Gene Name: RP11-481J2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
291-312
0.135
2
RP11-321M21.1
hsa-miR-3159
0.999

Gene Details
Chromosome: 18
Transcript: ENST00000579278
Biotype: lincRNA
Gene id: ENSG00000266774
Gene Name: RP11-321M21.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
251-268
0.132
12
FAM224A
hsa-miR-3159
0.999

Gene Details
Chromosome: Y
Transcript: ENST00000419557
Biotype: lincRNA
Gene id: ENSG00000233522
Gene Name: FAM224A
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1847-1870
0.130
1
XLOC_009222
hsa-miR-3159
0.998

Gene Details
Chromosome: chr11
Transcript: TCONS_00019399
Biotype: transcript isomorph
Gene id: XLOC_009222
Gene Name: XLOC_009222
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
4151-4171
0.065
1
7mer
5288-5307
0.027
1
8mer
4476-4496
0.020
1
AC006548.28
hsa-miR-3159
0.998

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
498-513
0.014
Not Conserved
8mer
56434-56446
0.006
Not Conserved
7mer
2252-2264
0.006
3
8mer
68935-68957
0.006
1
7mer
61473-61487
0.005
2
7mer
67717-67735
0.005
1
7mer
27777-27792
0.005
2
7mer
36817-36830
0.005
1
8mer
3830-3846
0.005
2
7mer
48023-48044
0.004
Not Conserved
7mer
21448-21462
0.004
2
7mer
30585-30597
0.004
2
7mer
53428-53443
0.004
Not Conserved
7mer
76874-76889
0.004
1
6mer
83760-83775
0.003
1
6mer
81115-81132
0.002
2
6mer
30075-30097
0.002
1
6mer
80503-80519
0.002
1
7mer
50364-50380
0.002
Not Conserved
6mer
40901-40911
0.002
2
6mer
27229-27249
0.002
2
6mer
29827-29848
0.002
2
6mer
67042-67068
0.002
Not Conserved
6mer
50787-50806
0.001
Not Conserved
8mer+wobble
17374-17396
0.001
1
6mer
55666-55687
0.001
1
6mer
78941-78962
0.001
1
6mer
49085-49089
0.001
Not Conserved
6mer
73579-73593
0.001
2
6mer
54833-54856
0.001
2
6mer
76659-76681
0.001
1
6mer
12321-12339
0.001
2
6mer
22866-22889
0.001
3
6mer
82652-82666
0.001
2
6mer
81007-81026
0.001
2
6mer
11154-11169
0.001
3
6mer
22795-22813
0.001
2
6mer
61837-61855
0.001
1
8mer+mismatch
66892-66910
0.000
1
AC024132.1
hsa-miR-3159
0.998

Gene Details
Chromosome: 4
Transcript: ENST00000382007
Biotype: lincRNA
Gene id: ENSG00000205830
Gene Name: AC024132.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2358-2379
0.109
9
XLOC_000199
hsa-miR-3159
0.996

Gene Details
Chromosome: chr1
Transcript: TCONS_00000200
Biotype: transcript isomorph
Gene id: XLOC_000199
Gene Name: XLOC_000199
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
732-749
0.074
2
9mer
1975-1995
0.028
1
KCNQ1OT1
hsa-miR-3159
0.995

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
20773-20787
0.009
2
7mer
33804-33822
0.007
1
7mer
23110-23136
0.006
2
7mer
18641-18661
0.006
2
7mer
27317-27339
0.005
1
7mer
70391-70414
0.005
4
7mer
47588-47609
0.005
5
8mer
71112-71119
0.004
1
7mer
69466-69481
0.004
3
7mer
81986-82011
0.003
1
6mer
11254-11268
0.003
2
7mer
29663-29680
0.002
1
8mer+wobble
70902-70923
0.002
2
7mer
37646-37663
0.002
1
7mer
57437-57457
0.002
2
6mer
25768-25790
0.002
1
6mer
71346-71355
0.002
2
6mer
30081-30100
0.002
1
6mer
39085-39108
0.002
1
6mer
49375-49400
0.002
2
6mer
28388-28392
0.002
1
8mer+mismatch
432-450
0.002
1
6mer
36525-36540
0.002
1
6mer
42244-42260
0.001
2
6mer
41798-41812
0.001
1
6mer
16879-16895
0.001
2
8mer+mismatch
19695-19713
0.001
2
6mer
39788-39801
0.001
1
6mer
28274-28297
0.001
1
6mer
44627-44642
0.001
2
6mer
45388-45413
0.001
2
6mer
58682-58703
0.001
2
7mer
81973-82000
0.001
1
6mer
18605-18627
0.001
2
8mer+mismatch
17512-17530
0.001
2
6mer
71337-71355
0.001
3
8mer+mismatch
3155-3173
0.001
1
6mer
37538-37556
0.001
1
8mer+mismatch
12786-12804
0.001
1
6mer
37510-37534
0.000
1
RP11-266K4.13
hsa-miR-3159
0.994

Gene Details
Chromosome: 12
Transcript: ENST00000611627
Biotype: lincRNA
Gene id: ENSG00000276417
Gene Name: RP11-266K4.13
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
537-551
0.087
2
6mer
268-286
0.007
1
XLOC_013437
hsa-miR-3159
0.993

Gene Details
Chromosome: chr20
Transcript: TCONS_00028093
Biotype: transcript isomorph
Gene id: XLOC_013437
Gene Name: XLOC_013437
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
66-84
0.090
4
6mer
1797-1821
0.003
1
XLOC_010651
hsa-miR-3159
0.990

Gene Details
Chromosome: chr13
Transcript: TCONS_00021516
Biotype: transcript isomorph
Gene id: XLOC_010651
Gene Name: XLOC_010651
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
433-447
0.040
2
7mer
181-186
0.020
2
7mer
133-158
0.015
1
7mer
2853-2871
0.008
2
6mer
1223-1239
0.003
2
LINC00550
hsa-miR-3159
0.990

Gene Details
Chromosome: 13
Transcript: NR_038878.1
Biotype: lincRNA
Gene id: NR_038878.1 (gene)
Gene Name: LINC00550
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
436-450
0.040
2
7mer
184-189
0.020
2
7mer
136-161
0.015
1
7mer
2856-2874
0.008
2
6mer
1226-1242
0.003
2
XLOC_006828
hsa-miR-3159
0.990

Gene Details
Chromosome: chr8
Transcript: TCONS_00014743
Biotype: transcript isomorph
Gene id: XLOC_006828
Gene Name: XLOC_006828
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1443-1455
0.038
2
8mer
1746-1766
0.034
2
8mer
1113-1132
0.014
1
AC068039.4
hsa-miR-3159
0.990

Gene Details
Chromosome: 2
Transcript: ENST00000416361
Biotype: antisense
Gene id: ENSG00000228389
Gene Name: AC068039.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2073-2093
0.059
1
8mer+mismatch
1995-2012
0.027
1
ZNF561-AS1
hsa-miR-3159
0.984

Gene Details
Chromosome: 19
Transcript: ENST00000586943
Biotype: retained_intron
Gene id: ENSG00000267106
Gene Name: ZNF561-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
293-309
0.069
1
8mer+mismatch
885-903
0.009
1
DNM3OS
hsa-miR-3159
0.982

Gene Details
Chromosome: 1
Transcript: ENST00000417354
Biotype: antisense
Gene id: ENSG00000230630
Gene Name: DNM3OS
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-3159
Sequence: uaggauuacaagugucggccac
MirBase ID: MIMAT0015033
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
94-118
0.072
5
6mer
3498-3524
0.002
2
6mer
2935-2955
0.002
2
Funded by: