Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34a-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
259629-259640
0.023
2
8mer
202219-202245
0.020
1
8mer
8232-8256
0.012
5
8mer
73872-73892
0.012
5
7mer
44089-44104
0.010
2
8mer
160616-160640
0.008
3
8mer
199550-199573
0.008
1
8mer
204872-204886
0.008
2
7mer
93757-93771
0.007
4
8mer
23719-23742
0.007
2
8mer
72007-72021
0.006
Not Conserved
7mer
196055-196074
0.006
4
7mer
123780-123794
0.005
4
7mer
110536-110559
0.005
2
7mer
195222-195243
0.005
4
7mer
29066-29086
0.005
4
7mer
196612-196639
0.005
4
7mer
9886-9913
0.004
3
6mer
206-226
0.004
1
8mer
247044-247070
0.004
1
7mer
57179-57204
0.003
2
7mer
131370-131389
0.003
1
7mer
21267-21281
0.003
2
6mer
126784-126792
0.003
6
7mer
116447-116467
0.003
2
7mer
225968-225989
0.003
4
8mer
222461-222485
0.003
1
7mer
33828-33848
0.002
3
7mer
120502-120520
0.002
3
7mer
42466-42483
0.002
3
7mer
30330-30350
0.002
2
7mer
84437-84456
0.002
1
6mer
186880-186897
0.002
7
6mer
57558-57580
0.002
6
6mer
139128-139142
0.002
1
6mer
119595-119619
0.002
9
7mer
118377-118393
0.002
3
6mer
3254-3277
0.002
7
7mer
194705-194730
0.002
Not Conserved
6mer
238927-238942
0.002
1
8mer
120722-120735
0.002
1
6mer
38521-38537
0.002
2
7mer
138887-138901
0.002
2
7mer
61021-61046
0.002
2
6mer
150099-150114
0.002
9
6mer
136789-136804
0.002
2
6mer
167653-167675
0.002
3
8mer+mismatch
95813-95833
0.002
2
6mer
65555-65576
0.002
1
6mer
88625-88649
0.002
2
6mer
9217-9238
0.002
4
6mer
20724-20749
0.002
10
7mer
23726-23752
0.002
Not Conserved
6mer
34685-34709
0.002
2
7mer
208421-208442
0.002
2
6mer
33386-33405
0.002
8
6mer
97752-97775
0.002
5
6mer
58028-58040
0.002
2
6mer
32520-32546
0.002
4
6mer
36042-36060
0.002
2
6mer
57722-57745
0.002
4
6mer
167076-167090
0.002
3
7mer
84504-84522
0.002
2
6mer
158563-158584
0.002
2
7mer
213997-214012
0.002
5
7mer
184398-184416
0.002
2
6mer
123971-123989
0.001
1
6mer
235753-235769
0.001
3
6mer
74757-74776
0.001
11
6mer
86064-86079
0.001
1
6mer
226732-226744
0.001
1
6mer
91803-91817
0.001
2
6mer
162946-162959
0.001
Not Conserved
6mer
129274-129292
0.001
4
6mer
23902-23922
0.001
2
6mer
246425-246446
0.001
1
6mer
67276-67287
0.001
2
6mer
180104-180122
0.001
4
6mer
159577-159603
0.001
1
6mer
43253-43277
0.001
3
6mer
110642-110664
0.001
8
6mer
195696-195714
0.001
2
6mer
265388-265404
0.001
2
6mer
185898-185922
0.001
1
6mer
650-674
0.001
2
6mer
37839-37865
0.001
2
6mer
208127-208151
0.001
1
6mer
227843-227866
0.001
3
6mer
99667-99685
0.001
2
6mer
220954-220980
0.001
2
6mer
117694-117720
0.001
2
6mer
254249-254266
0.001
2
6mer
216299-216317
0.001
4
6mer
100680-100700
0.001
6
6mer
124362-124386
0.001
4
6mer
87108-87135
0.001
4
6mer
228269-228295
0.001
1
6mer
184320-184344
0.001
2
6mer
211273-211295
0.001
3
7mer
214192-214216
0.001
2
6mer
188689-188710
0.001
2
6mer
255245-255262
0.001
2
6mer
233014-233035
0.001
2
6mer
6571-6592
0.001
2
6mer
131022-131040
0.001
3
6mer
257762-257773
0.001
4
6mer
136380-136402
0.001
1
6mer
74438-74456
0.001
2
6mer
62390-62417
0.001
3
6mer
162344-162358
0.001
1
6mer
200565-200590
0.001
4
6mer
122813-122824
0.001
1
6mer
241855-241874
0.001
2
6mer
123260-123286
0.001
2
6mer
239390-239411
0.001
1
6mer
70993-71020
0.001
1
6mer
12065-12088
0.001
2
6mer
139400-139416
0.001
2
6mer
21545-21570
0.001
1
6mer
253689-253702
0.001
2
6mer
206823-206849
0.001
2
6mer
68689-68716
0.001
3
6mer
97173-97200
0.001
2
6mer
128594-128613
0.001
3
6mer
30470-30483
0.001
1
6mer
133958-133974
0.001
1
6mer
168807-168827
0.001
1
6mer
97401-97423
0.001
2
6mer
29081-29101
0.001
2
6mer
58166-58193
0.001
3
6mer
137472-137489
0.001
2
6mer
96455-96473
0.001
2
6mer
74585-74608
0.001
5
6mer
111071-111097
0.001
1
6mer
104579-104600
0.001
Not Conserved
6mer
140152-140177
0.001
2
6mer
120609-120628
0.001
4
6mer
212054-212078
0.000
2
6mer
79831-79858
0.000
1
6mer
79908-79919
0.000
1
6mer
222470-222490
0.000
2
6mer
159631-159651
0.000
1
6mer
206839-206865
0.000
2
6mer
87121-87147
0.000
1
6mer
74774-74789
0.000
2
RP11-586K12.10
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000570084
Biotype: lincRNA
Gene id: ENSG00000260311
Gene Name: RP11-586K12.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
316-333
0.249
1
RP11-1437A8.4
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000565847
Biotype: lincRNA
Gene id: ENSG00000260827
Gene Name: RP11-1437A8.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
94-111
0.245
1
RP11-1437A8.4
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000563960
Biotype: lincRNA
Gene id: ENSG00000260827
Gene Name: RP11-1437A8.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
175-192
0.239
1
6mer
1312-1332
0.004
1
RP11-586K12.10
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000570183
Biotype: lincRNA
Gene id: ENSG00000260311
Gene Name: RP11-586K12.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2295-2312
0.229
1
6mer
1155-1175
0.004
1
RP11-529E10.6
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 4
Transcript: ENST00000564650
Biotype: sense_overlapping
Gene id: ENSG00000261643
Gene Name: RP11-529E10.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
48-66
0.228
1
XLOC_008106
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: chrX
Transcript: TCONS_00017284
Biotype: transcript isomorph
Gene id: XLOC_008106
Gene Name: XLOC_008106
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1623-1647
0.128
2
8mer
1328-1352
0.062
2
FOXN3-AS2
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 14
Transcript: ENST00000554071
Biotype: antisense
Gene id: ENSG00000259073
Gene Name: FOXN3-AS2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
40-59
0.169
8
XLOC_001401
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: chr2
Transcript: TCONS_00003609
Biotype: transcript isomorph
Gene id: XLOC_001401
Gene Name: XLOC_001401
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1954-1970
0.144
1
6mer
2199-2224
0.015
1
RP11-15L13.4
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 3
Transcript: ENST00000608818
Biotype: antisense
Gene id: ENSG00000272910
Gene Name: RP11-15L13.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
101-117
0.144
10
6mer
115-135
0.006
7
RP11-760D2.1
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 7
Transcript: ENST00000436042
Biotype: lincRNA
Gene id: ENSG00000225488
Gene Name: RP11-760D2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
558-574
0.148
2
XLOC_013708
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: chr20
Transcript: TCONS_00028355
Biotype: transcript isomorph
Gene id: XLOC_013708
Gene Name: XLOC_013708
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
870-887
0.133
1
6mer
331-347
0.007
1
6mer
791-818
0.005
1
KCNQ1OT1
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
22539-22565
0.010
2
8mer
62343-62355
0.009
2
8mer
64161-64181
0.008
3
8mer
33721-33744
0.007
1
7mer
41522-41540
0.007
2
7mer
52827-52842
0.007
2
7mer
61776-61802
0.006
3
8mer
77440-77465
0.006
2
8mer
25684-25703
0.005
1
7mer
65466-65491
0.004
2
8mer
55169-55196
0.004
1
8mer+wobble
81618-81645
0.004
2
7mer
80427-80441
0.003
2
7mer
54855-54870
0.003
2
7mer
62765-62791
0.003
2
7mer
59235-59255
0.002
3
6mer
56456-56473
0.002
4
6mer
46862-46883
0.002
7
6mer
91607-91622
0.002
1
7mer
44956-44978
0.002
2
6mer
80721-80746
0.002
6
6mer
69852-69877
0.002
1
6mer
78257-78277
0.002
1
6mer
5768-5794
0.002
2
6mer
85903-85926
0.002
4
6mer
50955-50978
0.002
3
6mer
3330-3355
0.001
2
6mer
36948-36972
0.001
1
6mer
76248-76266
0.001
3
6mer
6490-6515
0.001
2
6mer
70449-70474
0.001
1
6mer
61275-61297
0.001
4
6mer
5192-5203
0.001
2
6mer
9069-9093
0.001
2
6mer
86779-86798
0.001
3
6mer
37309-37328
0.001
1
6mer
64367-64387
0.001
4
6mer
47109-47128
0.001
2
6mer
82261-82272
0.001
2
6mer
47968-47993
0.001
2
6mer
57019-57035
0.001
2
6mer
68373-68400
0.001
3
6mer
31350-31368
0.001
1
6mer
45610-45631
0.001
2
7mer
36796-36810
0.001
1
6mer
59909-59929
0.001
2
6mer
85766-85782
0.001
4
6mer
62603-62621
0.001
1
6mer
82444-82466
0.001
4
6mer
31583-31606
0.001
1
6mer
56167-56186
0.001
2
6mer
59794-59814
0.001
2
6mer
47431-47443
0.001
1
6mer
86630-86657
0.001
2
6mer
74216-74237
0.001
1
6mer
36808-36829
0.001
1
6mer
62305-62327
0.001
2
6mer
36606-36622
0.001
Not Conserved
6mer
86658-86677
0.000
2
6mer
37246-37264
0.000
1
6mer
37228-37250
0.000
1
RP4-782L23.2
hsa-miR-34a-5p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000443012
Biotype: antisense
Gene id: ENSG00000226883
Gene Name: RP4-782L23.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
597-614
0.113
6
8mer
116-129
0.023
3
6mer
45-68
0.003
2
RP1-45N11.1
hsa-miR-34a-5p
0.999

Gene Details
Chromosome: 6
Transcript: ENST00000569865
Biotype: lincRNA
Gene id: ENSG00000260271
Gene Name: RP1-45N11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Lymph Node Normal/Primary


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1250-1268
0.134
9
RP13-348B13.2
hsa-miR-34a-5p
0.999

Gene Details
Chromosome: X
Transcript: ENST00000420327
Biotype: lincRNA
Gene id: ENSG00000225012
Gene Name: RP13-348B13.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
162-178
0.134
4
RP11-104J23.2
hsa-miR-34a-5p
0.999

Gene Details
Chromosome: 17
Transcript: ENST00000617747
Biotype: lincRNA
Gene id: ENSG00000278690
Gene Name: RP11-104J23.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
249-268
0.062
2
8mer
192-212
0.050
2
6mer
226-249
0.010
2
6mer
102-124
0.007
1
LINC01122
hsa-miR-34a-5p
0.999

Gene Details
Chromosome: 2
Transcript: ENST00000427421
Biotype: lincRNA
Gene id: ENSG00000233723
Gene Name: LINC01122
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
414-437
0.108
11
7mer
212-225
0.011
3
XLOC_010921
hsa-miR-34a-5p
0.999

Gene Details
Chromosome: chr14
Transcript: TCONS_00022619
Biotype: transcript isomorph
Gene id: XLOC_010921
Gene Name: XLOC_010921
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
328-347
0.118
3
RP1-71H24.6
hsa-miR-34a-5p
0.999

Gene Details
Chromosome: 12
Transcript: ENST00000614658
Biotype: lincRNA
Gene id: ENSG00000276343
Gene Name: RP1-71H24.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34a-5p
Sequence: uggcagugucuuagcugguugu
MirBase ID: MIMAT0000255
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
422-445
0.060
2
7mer
56-81
0.045
2
6mer
270-291
0.012
2
Funded by: