Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-34c-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-34c-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
259629-259639
0.014
2
9mer
73873-73893
0.011
5
9mer
160617-160641
0.008
3
7mer
202219-202244
0.008
1
9mer
204873-204887
0.007
2
7mer
126784-126793
0.006
6
7mer
8231-8255
0.006
5
7mer
65555-65577
0.006
1
7mer
238928-238943
0.006
1
7mer
195225-195243
0.005
4
7mer
167651-167676
0.005
2
7mer
136783-136805
0.005
2
7mer
72004-72020
0.004
2
7mer
34685-34710
0.004
2
7mer
199550-199572
0.004
2
7mer
36043-36061
0.004
2
8mer
84432-84457
0.004
1
7mer
23727-23741
0.004
2
8mer
194707-194731
0.003
Not Conserved
7mer
123976-123990
0.003
1
7mer
86056-86080
0.003
1
6mer
120507-120519
0.003
9
8mer
138881-138902
0.003
2
6mer
266920-266933
0.003
1
6mer
75903-75925
0.003
5
7mer
225971-225989
0.003
4
6mer
131705-131726
0.003
7
6mer
148124-148151
0.003
5
6mer
48313-48337
0.003
3
6mer
13097-13117
0.002
8
9mer
222474-222486
0.002
1
6mer
4062-4083
0.002
6
6mer
133318-133343
0.002
4
7mer
118370-118393
0.002
3
6mer
139117-139142
0.002
1
6mer
88623-88649
0.002
4
6mer
187667-187686
0.002
1
6mer
123780-123793
0.002
4
7mer
61021-61046
0.002
2
6mer
196242-196268
0.002
5
6mer
54964-54983
0.002
2
7mer
120717-120734
0.002
1
6mer
200031-200047
0.002
2
7mer
247044-247069
0.002
1
6mer
196798-196823
0.002
3
8mer
213997-214013
0.002
3
6mer
38521-38537
0.002
2
6mer
38116-38132
0.002
4
6mer
114628-114646
0.002
8
6mer
119597-119619
0.002
9
6mer
49029-49054
0.002
2
6mer
94124-94149
0.002
4
6mer
196055-196073
0.002
4
6mer
6110-6136
0.002
Not Conserved
6mer
196612-196638
0.002
4
6mer
93760-93770
0.002
4
6mer
93631-93652
0.002
5
6mer
49487-49512
0.002
6
6mer
22745-22768
0.002
2
6mer
9894-9912
0.002
3
6mer
164923-164948
0.002
3
6mer
29059-29085
0.002
3
6mer
208220-208243
0.002
2
6mer
110533-110558
0.002
2
7mer
134190-134210
0.002
1
7mer
6572-6593
0.002
2
6mer
158569-158584
0.002
2
7mer
84506-84522
0.002
2
7mer
74438-74457
0.002
2
6mer
21256-21280
0.002
2
7mer
162335-162359
0.002
1
6mer
183167-183194
0.002
5
6mer
157458-157480
0.002
2
6mer
210931-210951
0.002
Not Conserved
6mer
42466-42482
0.002
4
6mer
150960-150975
0.002
1
6mer
97762-97775
0.002
3
6mer
209841-209856
0.002
5
6mer
55270-55291
0.002
4
6mer
131371-131388
0.002
1
6mer
33828-33847
0.001
3
6mer
124556-124577
0.001
2
6mer
108273-108296
0.001
Not Conserved
6mer
159301-159327
0.001
1
6mer
181862-181885
0.001
3
6mer
182967-182991
0.001
2
6mer
43603-43630
0.001
3
6mer
203202-203215
0.001
2
6mer
143918-143938
0.001
4
7mer
12069-12089
0.001
2
6mer
170013-170030
0.001
2
6mer
99161-99182
0.001
2
6mer
74962-74978
0.001
6
6mer
202715-202741
0.001
Not Conserved
6mer
110641-110664
0.001
8
6mer
195698-195713
0.001
2
6mer
119912-119934
0.001
6
6mer
43416-43431
0.001
4
6mer
18059-18079
0.001
1
6mer
136461-136475
0.001
2
6mer
57180-57203
0.001
2
6mer
30688-30711
0.001
4
6mer
130915-130939
0.001
2
6mer
169443-169465
0.001
2
6mer
223942-223962
0.001
2
6mer
118948-118969
0.001
1
6mer
70814-70838
0.001
2
6mer
24936-24955
0.001
2
6mer
258206-258223
0.001
2
6mer
111204-111214
0.001
1
6mer
194384-194407
0.001
2
6mer
26350-26368
0.001
2
6mer
154321-154344
0.001
5
6mer
77649-77671
0.001
1
6mer
95106-95132
0.001
2
6mer
42874-42893
0.001
2
6mer
2210-2224
0.001
2
6mer
116249-116270
0.001
2
6mer
94874-94896
0.001
2
6mer
30330-30349
0.001
2
6mer
43253-43277
0.001
2
6mer
133760-133782
0.001
2
6mer
141465-141492
0.001
5
6mer
50194-50209
0.001
1
6mer
174187-174205
0.001
2
6mer
235705-235726
0.001
3
6mer
154409-154429
0.001
4
6mer
116405-116426
0.001
1
6mer
243135-243154
0.001
1
6mer
252319-252341
0.001
1
6mer
214709-214727
0.001
2
6mer
61288-61304
0.001
2
6mer
263628-263645
0.001
Not Conserved
6mer
79804-79821
0.001
2
6mer
184398-184415
0.001
2
6mer
226377-226392
0.001
2
6mer
84856-84882
0.001
2
6mer
105476-105490
0.001
2
6mer
228719-228733
0.001
2
6mer
216682-216705
0.001
1
6mer
15422-15444
0.001
2
7mer
74765-74790
0.001
2
6mer
5445-5459
0.001
1
6mer
97141-97163
0.001
2
6mer
17739-17759
0.001
2
6mer
164518-164538
0.001
1
6mer
131159-131181
0.001
2
6mer
156330-156346
0.001
3
6mer
201773-201787
0.001
Not Conserved
6mer
177091-177112
0.001
2
6mer
208423-208441
0.001
2
6mer
247416-247430
0.001
1
6mer
211999-212022
0.001
2
6mer
127686-127708
0.001
1
6mer
207893-207908
0.001
1
6mer
134754-134768
0.001
2
6mer
188693-188710
0.001
2
6mer
215258-215277
0.001
3
6mer
161425-161443
0.001
1
6mer
176115-176135
0.001
2
6mer
255379-255401
0.001
2
6mer
67446-67470
0.001
2
6mer
200449-200476
0.001
2
6mer
84648-84670
0.001
4
6mer
138652-138679
0.001
1
6mer
160874-160888
0.001
1
6mer
124673-124694
0.001
5
6mer
224168-224184
0.001
2
6mer
58748-58767
0.001
1
6mer
218902-218915
0.001
2
6mer
110072-110094
0.001
2
6mer
90691-90711
0.001
2
6mer
63715-63728
0.001
2
6mer
117921-117943
0.001
2
6mer
64079-64101
0.001
2
6mer
182273-182292
0.001
1
6mer
218346-218368
0.001
2
6mer
18847-18868
0.001
2
6mer
195364-195389
0.001
1
6mer
18157-18173
0.001
2
6mer
137974-137996
0.001
1
6mer
80045-80063
0.001
2
6mer
90456-90480
0.001
3
6mer
76106-76128
0.001
1
6mer
203334-203350
0.001
1
6mer
71372-71386
0.001
1
6mer
253842-253855
0.001
1
6mer
95555-95567
0.001
2
6mer
216136-216154
0.001
2
6mer
147252-147264
0.001
1
6mer
6174-6200
0.001
4
6mer
239443-239468
0.001
1
6mer
112667-112689
0.001
1
6mer
219063-219077
0.001
2
6mer
133959-133974
0.001
1
6mer
215745-215759
0.001
2
6mer
265307-265334
0.001
1
6mer
227235-227252
0.001
2
6mer
7170-7196
0.001
1
6mer
249555-249574
0.001
1
6mer
134095-134113
0.001
1
6mer
177245-177269
0.001
1
6mer
138274-138299
0.001
1
6mer
36742-36768
0.001
2
6mer
125963-125990
0.001
1
6mer
43984-44010
0.001
1
6mer
30465-30483
0.001
1
6mer
261220-261245
0.001
2
6mer
241725-241743
0.001
1
6mer
158190-158217
0.001
2
6mer
244585-244612
0.001
1
6mer
70957-70983
0.001
1
6mer
133331-133352
0.001
1
6mer
84741-84757
0.001
2
6mer
265386-265404
0.001
2
6mer
29079-29101
0.001
2
6mer
214196-214215
0.001
2
6mer
112798-112822
0.001
1
6mer
90123-90149
0.001
1
6mer
183059-183073
0.001
3
6mer
116445-116466
0.001
2
6mer
247216-247240
0.001
Not Conserved
6mer
76244-76257
0.001
1
6mer
23727-23751
0.001
Not Conserved
6mer
54995-55017
0.001
2
6mer
197402-197427
0.001
1
6mer
19010-19027
0.001
2
6mer
138299-138325
0.001
1
6mer
108354-108380
0.001
2
6mer
247538-247565
0.001
1
6mer
252402-252415
0.000
4
6mer
125994-126016
0.000
2
6mer
177122-177138
0.000
2
6mer
36777-36794
0.000
2
6mer
247091-247105
0.000
1
6mer
90469-90484
0.000
2
6mer
159314-159338
0.000
Not Conserved
6mer
95555-95571
0.000
2
6mer
261254-261271
0.000
Not Conserved
6mer
76244-76261
0.000
1
6mer
247058-247079
0.000
1
LINC01224
hsa-miR-34c-5p
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000596283
Biotype: lincRNA
Gene id: ENSG00000269416
Gene Name: LINC01224
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2479-2505
0.043
2
6mer
2614-2634
0.017
2
6mer
2696-2719
0.013
2
6mer
2357-2377
0.011
2
6mer
1032-1056
0.010
2
6mer
2441-2459
0.009
2
7mer
2625-2650
0.008
1
6mer
711-732
0.007
2
6mer
1631-1655
0.007
2
6mer
950-972
0.007
2
6mer
1448-1472
0.005
2
6mer
1372-1387
0.004
2
6mer
1847-1869
0.003
1
6mer
550-567
0.003
1
6mer
1252-1271
0.002
1
RP11-586K12.10
hsa-miR-34c-5p
0.999

Gene Details
Chromosome: 16
Transcript: ENST00000570084
Biotype: lincRNA
Gene id: ENSG00000260311
Gene Name: RP11-586K12.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
307-332
0.134
1
RP11-1437A8.4
hsa-miR-34c-5p
0.999

Gene Details
Chromosome: 16
Transcript: ENST00000565847
Biotype: lincRNA
Gene id: ENSG00000260827
Gene Name: RP11-1437A8.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
95-120
0.131
1
RP11-1437A8.4
hsa-miR-34c-5p
0.999

Gene Details
Chromosome: 16
Transcript: ENST00000563960
Biotype: lincRNA
Gene id: ENSG00000260827
Gene Name: RP11-1437A8.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
176-201
0.127
1
KCNQ1OT1
hsa-miR-34c-5p
0.999

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
62342-62363
0.010
2
9mer
33720-33743
0.008
1
9mer
25683-25703
0.006
1
7mer
64162-64180
0.004
3
7mer
85501-85525
0.004
2
7mer
65466-65487
0.004
2
7mer
3329-3354
0.004
2
7mer
56455-56471
0.003
4
7mer
77441-77460
0.003
2
6mer
22540-22565
0.003
2
6mer
86396-86423
0.003
4
6mer
45302-45320
0.003
4
6mer
41523-41539
0.002
2
6mer
61777-61800
0.002
3
7mer
47108-47130
0.002
2
7mer
55170-55185
0.002
1
6mer
52828-52845
0.002
2
6mer
80721-80741
0.002
6
6mer
47003-47022
0.002
6
6mer
63333-63356
0.002
4
6mer
40801-40814
0.002
2
6mer
89803-89815
0.002
5
7mer
59908-59931
0.002
2
6mer
79770-79782
0.002
4
6mer
46434-46448
0.002
2
7mer
31349-31371
0.002
1
6mer
55868-55881
0.002
2
7mer
44956-44977
0.002
2
7mer
37245-37264
0.002
1
6mer
59236-59255
0.002
3
6mer
61275-61288
0.002
4
6mer
88802-88820
0.001
2
6mer
80428-80444
0.001
2
6mer
70509-70531
0.001
2
6mer
86591-86612
0.001
3
6mer
83409-83431
0.001
2
6mer
55058-55079
0.001
4
6mer
60095-60111
0.001
3
6mer
56875-56885
0.001
4
6mer
54856-54861
0.001
2
6mer
63599-63613
0.001
2
6mer
36948-36972
0.001
1
6mer
19468-19480
0.001
2
6mer
75417-75437
0.001
2
6mer
47968-47985
0.001
2
6mer
57019-57042
0.001
2
6mer
62766-62790
0.001
2
6mer
46100-46125
0.001
2
6mer
57965-57980
0.001
2
6mer
37120-37139
0.001
1
6mer
63115-63140
0.001
1
6mer
64789-64815
0.001
2
6mer
47314-47332
0.001
2
6mer
36797-36812
0.001
1
6mer
90260-90287
0.001
1
6mer
39781-39794
0.001
1
6mer
38205-38232
0.001
1
6mer
31501-31519
0.001
1
6mer
54991-55017
0.001
2
6mer
39655-39668
0.001
1
6mer
23785-23812
0.001
1
6mer
77421-77440
0.000
2
6mer
63564-63586
0.000
3
6mer
61750-61767
0.000
2
6mer
83386-83403
0.000
3
6mer
31497-31519
0.000
1
RP13-580B18.4
hsa-miR-34c-5p
0.999

Gene Details
Chromosome: 7
Transcript: ENST00000624628
Biotype: lincRNA
Gene id: ENSG00000279072
Gene Name: RP13-580B18.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
111-128
0.004
1
6mer
23770-23793
0.003
1
7mer
23101-23123
0.002
1
6mer
212-239
0.002
1
6mer
543-565
0.002
1
6mer
347-366
0.002
1
6mer
594-609
0.002
1
7mer
23643-23668
0.002
Not Conserved
6mer
23388-23404
0.002
Not Conserved
6mer
23579-23602
0.002
1
6mer
23356-23372
0.002
1
6mer
22769-22789
0.002
Not Conserved
6mer
23263-23280
0.002
1
7mer
19740-19760
0.002
Not Conserved
7mer
1115-1120
0.002
Not Conserved
6mer
21290-21315
0.001
2
6mer
19268-19284
0.001
1
6mer
23168-23183
0.001
1
6mer
19808-19824
0.001
1
6mer
22937-22962
0.001
2
6mer
10282-10304
0.001
1
6mer
22366-22391
0.001
1
6mer
20372-20386
0.001
1
6mer
10646-10673
0.001
1
6mer
20682-20699
0.001
Not Conserved
6mer
20151-20168
0.001
1
6mer
18646-18662
0.001
1
6mer
2901-2927
0.001
Not Conserved
6mer
19004-19021
0.001
1
6mer
20848-20875
0.001
1
6mer
3977-3993
0.001
1
6mer
21191-21207
0.001
1
6mer
19644-19671
0.001
1
6mer
3713-3740
0.001
1
6mer
6430-6456
0.001
1
6mer
18469-18495
0.001
1
6mer
22652-22677
0.001
1
6mer
1577-1593
0.001
Not Conserved
6mer
1327-1353
0.001
Not Conserved
6mer
22077-22093
0.001
1
6mer
6558-6580
0.001
Not Conserved
6mer
8444-8466
0.001
Not Conserved
6mer
15853-15875
0.001
Not Conserved
6mer
1226-1252
0.001
Not Conserved
6mer
23069-23091
0.001
1
6mer
20469-20492
0.001
1
6mer
4768-4790
0.001
Not Conserved
6mer
21852-21878
0.001
Not Conserved
6mer
14475-14498
0.001
Not Conserved
6mer
14798-14825
0.001
Not Conserved
6mer
4293-4309
0.001
2
6mer
8808-8835
0.001
Not Conserved
6mer
3390-3413
0.001
Not Conserved
6mer
6922-6945
0.001
Not Conserved
6mer
18055-18082
0.001
Not Conserved
6mer
17563-17589
0.001
Not Conserved
6mer
7509-7525
0.001
Not Conserved
6mer
12264-12286
0.001
Not Conserved
6mer
12628-12655
0.001
Not Conserved
6mer
5132-5159
0.001
Not Conserved
6mer
14102-14124
0.001
Not Conserved
6mer
16217-16244
0.001
Not Conserved
6mer
18972-18988
0.001
1
6mer
2223-2239
0.001
Not Conserved
6mer
9395-9411
0.001
Not Conserved
6mer
13215-13231
0.001
Not Conserved
6mer
5719-5735
0.001
Not Conserved
6mer
11233-11249
0.001
Not Conserved
6mer
9131-9158
0.001
Not Conserved
6mer
16804-16820
0.001
Not Conserved
6mer
22715-22742
0.001
1
6mer
1959-1976
0.001
Not Conserved
6mer
15062-15078
0.001
Not Conserved
6mer
6035-6059
0.001
1
6mer
5455-5482
0.001
Not Conserved
6mer
8316-8342
0.001
Not Conserved
6mer
22969-22984
0.001
Not Conserved
6mer
22973-22996
0.001
Not Conserved
6mer
10969-10996
0.001
Not Conserved
6mer
5906-5923
0.001
1
6mer
17691-17713
0.001
Not Conserved
6mer
12136-12162
0.001
Not Conserved
6mer
18903-18919
0.001
1
6mer
15725-15751
0.001
Not Conserved
6mer
10154-10180
0.001
Not Conserved
6mer
4640-4666
0.001
Not Conserved
6mer
7245-7272
0.001
Not Conserved
6mer
21689-21716
0.001
Not Conserved
6mer
16540-16567
0.001
Not Conserved
6mer
4164-4181
0.001
1
6mer
12951-12978
0.001
Not Conserved
6mer
21531-21558
0.001
Not Conserved
6mer
22270-22294
0.001
1
6mer
22045-22072
0.001
1
6mer
4537-4557
0.001
Not Conserved
6mer
13974-14000
0.001
Not Conserved
6mer
1295-1311
0.001
Not Conserved
6mer
21100-21115
0.001
1
6mer
19454-19471
0.001
1
6mer
20614-20634
0.001
1
6mer
21036-21059
0.001
1
6mer
22266-22283
0.000
1
6mer
20618-20634
0.000
1
6mer
8213-8233
0.000
Not Conserved
6mer
2473-2490
0.000
Not Conserved
6mer
15622-15642
0.000
Not Conserved
6mer
10051-10071
0.000
Not Conserved
6mer
15249-15266
0.000
Not Conserved
6mer
2602-2618
0.000
Not Conserved
6mer
3681-3706
0.000
1
6mer
19581-19597
0.000
1
6mer
12919-12944
0.000
1
6mer
22620-22645
0.000
1
6mer
6426-6447
0.000
1
6mer
16991-17008
0.000
Not Conserved
6mer
13871-13891
0.000
Not Conserved
6mer
2798-2818
0.000
Not Conserved
6mer
21004-21029
0.000
1
6mer
1830-1847
0.000
Not Conserved
6mer
14766-14790
0.000
Not Conserved
6mer
6327-6347
0.000
Not Conserved
6mer
12033-12053
0.000
Not Conserved
6mer
2181-2199
0.000
Not Conserved
6mer
17460-17480
0.000
Not Conserved
6mer
9711-9727
0.000
Not Conserved
6mer
21626-21642
0.000
Not Conserved
6mer
17120-17136
0.000
Not Conserved
6mer
2702-2721
0.000
Not Conserved
6mer
15378-15394
0.000
Not Conserved
6mer
20340-20365
0.000
1
6mer
22013-22039
0.000
Not Conserved
6mer
9582-9599
0.000
Not Conserved
6mer
20596-20610
0.000
1
6mer
7825-7841
0.000
Not Conserved
6mer
13531-13547
0.000
Not Conserved
6mer
11549-11565
0.000
Not Conserved
6mer
21286-21306
0.000
1
6mer
16508-16532
0.000
Not Conserved
6mer
13402-13419
0.000
Not Conserved
6mer
7696-7713
0.000
Not Conserved
6mer
18350-18366
0.000
Not Conserved
6mer
11420-11437
0.000
Not Conserved
6mer
7213-7229
0.000
Not Conserved
6mer
5423-5439
0.000
Not Conserved
6mer
9099-9115
0.000
Not Conserved
6mer
18382-18399
0.000
Not Conserved
6mer
15721-15742
0.000
Not Conserved
6mer
10937-10953
0.000
Not Conserved
6mer
10150-10171
0.000
Not Conserved
6mer
22234-22250
0.000
1
6mer
12132-12153
0.000
Not Conserved
6mer
13823-13842
0.000
1
6mer
17559-17575
0.000
Not Conserved
6mer
8312-8333
0.000
Not Conserved
6mer
4636-4657
0.000
Not Conserved
6mer
15574-15593
0.000
Not Conserved
6mer
2897-2918
0.000
Not Conserved
6mer
18253-18273
0.000
Not Conserved
6mer
8117-8136
0.000
Not Conserved
6mer
11985-12004
0.000
Not Conserved
6mer
8069-8088
0.000
Not Conserved
6mer
6135-6154
0.000
Not Conserved
6mer
13679-13698
0.000
Not Conserved
6mer
9907-9926
0.000
Not Conserved
6mer
13970-13991
0.000
Not Conserved
6mer
11697-11716
0.000
Not Conserved
6mer
17316-17335
0.000
Not Conserved
6mer
6183-6202
0.000
Not Conserved
6mer
17412-17431
0.000
Not Conserved
6mer
8021-8040
0.000
Not Conserved
6mer
11841-11860
0.000
Not Conserved
6mer
11793-11812
0.000
Not Conserved
6mer
4441-4460
0.000
Not Conserved
6mer
11937-11956
0.000
Not Conserved
6mer
13631-13650
0.000
Not Conserved
6mer
15478-15497
0.000
Not Conserved
6mer
13727-13749
0.000
Not Conserved
6mer
8165-8184
0.000
Not Conserved
6mer
10003-10022
0.000
Not Conserved
6mer
17364-17383
0.000
Not Conserved
6mer
6279-6298
0.000
Not Conserved
6mer
11649-11668
0.000
Not Conserved
6mer
9955-9974
0.000
Not Conserved
6mer
4489-4508
0.000
Not Conserved
6mer
11889-11908
0.000
Not Conserved
6mer
9859-9878
0.000
Not Conserved
6mer
17220-17239
0.000
Not Conserved
6mer
4393-4412
0.000
Not Conserved
6mer
7973-7992
0.000
Not Conserved
6mer
7925-7944
0.000
Not Conserved
6mer
17268-17287
0.000
Not Conserved
6mer
9811-9830
0.000
Not Conserved
6mer
6231-6250
0.000
Not Conserved
6mer
15526-15545
0.000
Not Conserved
6mer
11745-11767
0.000
Not Conserved
6mer
13775-13797
0.000
Not Conserved
RP11-586K12.10
hsa-miR-34c-5p
0.999

Gene Details
Chromosome: 16
Transcript: ENST00000570183
Biotype: lincRNA
Gene id: ENSG00000260311
Gene Name: RP11-586K12.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2286-2311
0.121
1
XLOC_008106
hsa-miR-34c-5p
0.999

Gene Details
Chromosome: chrX
Transcript: TCONS_00017284
Biotype: transcript isomorph
Gene id: XLOC_008106
Gene Name: XLOC_008106
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1328-1342
0.069
2
7mer
1624-1647
0.052
2
MIR4534
hsa-miR-34c-5p
0.998

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
38270-38289
0.005
2
9mer
39006-39030
0.004
3
7mer
42824-42849
0.003
2
7mer
51577-51603
0.003
2
7mer
32142-32163
0.003
3
6mer
54469-54489
0.003
1
8mer
42015-42036
0.002
1
7mer
34565-34583
0.002
1
7mer
25033-25057
0.002
4
7mer
27171-27193
0.002
2
6mer
10522-10543
0.002
2
7mer
9553-9572
0.002
2
6mer
873-898
0.002
1
6mer
8556-8576
0.002
5
7mer
20365-20388
0.002
2
7mer
47895-47917
0.002
3
6mer
10797-10818
0.002
2
8mer
18664-18689
0.002
2
6mer
18615-18632
0.002
5
6mer
24400-24413
0.002
5
6mer
21290-21310
0.002
3
6mer
32836-32845
0.002
3
6mer
45706-45725
0.002
2
6mer
25762-25786
0.002
7
6mer
48543-48567
0.002
2
6mer
34881-34903
0.001
2
6mer
8926-8949
0.001
2
6mer
53540-53565
0.001
2
6mer
20183-20210
0.001
3
6mer
48133-48155
0.001
1
6mer
3922-3938
0.001
2
6mer
3081-3101
0.001
2
7mer
25569-25583
0.001
1
6mer
26698-26717
0.001
2
6mer
33057-33079
0.001
3
6mer
28904-28930
0.001
1
6mer
6050-6066
0.001
2
6mer
26366-26390
0.001
2
6mer
1581-1601
0.001
2
6mer
49169-49185
0.001
1
7mer
48207-48227
0.001
2
6mer
12931-12954
0.001
1
6mer
7836-7853
0.001
2
6mer
42070-42090
0.001
4
6mer
5755-5768
0.001
1
6mer
10065-10076
0.001
2
6mer
37033-37056
0.001
2
6mer
49932-49947
0.001
4
6mer
3563-3579
0.001
1
6mer
9930-9952
0.001
1
6mer
36502-36521
0.001
4
6mer
24526-24548
0.001
2
6mer
21036-21052
0.001
2
6mer
49006-49023
0.001
1
6mer
44136-44158
0.001
1
6mer
12593-12612
0.001
1
6mer
39171-39195
0.001
3
6mer
37917-37939
0.001
2
6mer
49397-49414
0.001
2
6mer
43000-43017
0.001
2
6mer
22688-22709
0.001
2
6mer
30841-30861
0.001
1
6mer
52320-52345
0.001
3
6mer
26069-26090
0.001
2
6mer
16284-16309
0.001
2
6mer
1331-1353
0.001
1
6mer
14872-14889
0.001
1
6mer
11682-11708
0.001
2
6mer
41447-41473
0.001
1
6mer
1685-1698
0.001
1
6mer
11935-11961
0.001
Not Conserved
6mer
30658-30675
0.001
Not Conserved
6mer
11515-11541
0.001
2
7mer
31187-31208
0.001
1
6mer
53248-53270
0.001
2
6mer
29064-29084
0.001
2
6mer
5281-5304
0.001
1
6mer
30493-30514
0.001
2
6mer
14402-14428
0.001
Not Conserved
6mer
36352-36374
0.001
1
6mer
48731-48757
0.001
1
6mer
41521-41538
0.001
3
6mer
41651-41671
0.001
1
6mer
53274-53296
0.001
2
6mer
12108-12135
0.001
1
6mer
1852-1876
0.001
2
6mer
1829-1850
0.000
2
6mer
26099-26116
0.000
3
6mer
14432-14454
0.000
1
6mer
14560-14584
0.000
Not Conserved
6mer
12135-12161
0.000
1
6mer
11965-11987
0.000
1
6mer
37925-37943
0.000
2
6mer
39024-39043
0.000
2
6mer
14562-14588
0.000
Not Conserved
XLOC_011693
hsa-miR-34c-5p
0.998

Gene Details
Chromosome: chr16
Transcript: TCONS_00024250
Biotype: transcript isomorph
Gene id: XLOC_011693
Gene Name: XLOC_011693
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
353-373
0.039
1
7mer
1924-1937
0.024
1
6mer
1860-1883
0.021
1
6mer
1209-1230
0.010
1
6mer
1334-1353
0.010
1
9mer
1062-1076
0.006
Not Conserved
6mer
625-639
0.002
Not Conserved
RP11-458F8.4
hsa-miR-34c-5p
0.998

Gene Details
Chromosome: 7
Transcript: ENST00000610177
Biotype: lincRNA
Gene id: ENSG00000273142
Gene Name: RP11-458F8.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
3396-3409
0.009
2
6mer
3047-3069
0.006
2
6mer
3236-3250
0.006
2
6mer
3134-3151
0.006
2
6mer
3188-3214
0.006
2
6mer
3265-3282
0.006
1
6mer
3092-3119
0.005
2
6mer
2796-2815
0.005
2
6mer
2932-2953
0.005
2
6mer
518-544
0.004
2
6mer
3236-3261
0.004
1
6mer
2579-2593
0.004
2
6mer
485-512
0.004
2
6mer
3361-3377
0.003
1
6mer
110-126
0.003
1
6mer
299-325
0.003
1
6mer
2822-2847
0.003
2
6mer
928-943
0.002
2
6mer
2980-3006
0.002
1
6mer
814-836
0.002
1
6mer
2371-2387
0.002
2
6mer
852-875
0.002
2
6mer
2042-2068
0.002
1
6mer
594-617
0.002
1
6mer
2307-2324
0.001
2
6mer
2672-2688
0.001
1
6mer
1014-1040
0.001
1
6mer
2182-2193
0.001
1
6mer
1246-1263
0.001
1
6mer
1537-1564
0.001
2
6mer
2234-2256
0.001
1
6mer
1798-1825
0.001
1
6mer
1414-1430
0.001
2
6mer
959-975
0.001
1
6mer
2262-2288
0.001
1
6mer
1714-1730
0.001
2
6mer
1618-1634
0.001
2
7mer
2084-2100
0.001
Not Conserved
6mer
1333-1355
0.000
Not Conserved
6mer
1338-1362
0.000
1
RP11-104J23.2
hsa-miR-34c-5p
0.997

Gene Details
Chromosome: 17
Transcript: ENST00000617747
Biotype: lincRNA
Gene id: ENSG00000278690
Gene Name: RP11-104J23.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
249-268
0.062
2
9mer
189-213
0.046
2
AC006548.28
hsa-miR-34c-5p
0.997

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
41696-41718
0.015
2
8mer
48149-48174
0.009
Not Conserved
7mer
28444-28463
0.004
2
7mer
3683-3701
0.004
2
8mer
12821-12840
0.003
Not Conserved
7mer
35659-35677
0.003
2
6mer
27868-27891
0.003
2
6mer
84071-84092
0.002
2
6mer
11112-11116
0.002
2
6mer
64440-64450
0.002
2
7mer
14041-14064
0.002
1
6mer
16867-16886
0.002
1
6mer
76963-76978
0.002
1
6mer
36148-36168
0.002
5
6mer
75655-75674
0.002
1
7mer
4183-4203
0.002
1
6mer
53176-53193
0.002
Not Conserved
7mer
68972-68992
0.002
1
6mer
65208-65224
0.002
1
6mer
60734-60748
0.002
2
6mer
39870-39892
0.001
2
6mer
11879-11892
0.001
1
6mer
24303-24322
0.001
2
6mer
5029-5046
0.001
2
6mer
65475-65491
0.001
2
6mer
82886-82909
0.001
2
6mer
74591-74609
0.001
1
6mer
59672-59695
0.001
2
6mer
78198-78209
0.001
1
6mer
68443-68458
0.001
1
6mer
10460-10476
0.001
1
6mer
59950-59972
0.001
Not Conserved
6mer
32699-32719
0.001
2
6mer
17267-17290
0.001
1
6mer
38136-38156
0.001
2
6mer
7174-7193
0.001
2
6mer
9347-9361
0.001
2
6mer
74832-74854
0.001
1
6mer
26316-26341
0.001
2
6mer
9015-9035
0.001
Not Conserved
6mer
7730-7756
0.001
2
6mer
18096-18119
0.001
Not Conserved
6mer
20883-20909
0.001
2
6mer
40558-40580
0.001
2
6mer
20169-20196
0.001
2
6mer
72146-72168
0.001
Not Conserved
6mer
45534-45556
0.001
Not Conserved
6mer
19386-19406
0.001
1
8mer
59933-59956
0.001
2
6mer
6316-6336
0.001
2
6mer
35864-35884
0.001
2
6mer
17541-17562
0.001
1
6mer
36005-36024
0.001
1
6mer
21202-21223
0.001
Not Conserved
6mer
39309-39333
0.001
1
6mer
34605-34621
0.001
Not Conserved
6mer
22347-22370
0.001
1
6mer
17103-17119
0.001
2
6mer
17185-17208
0.001
1
6mer
59634-59658
0.001
1
6mer
3657-3670
0.000
3
6mer
17178-17201
0.000
1
6mer
17260-17283
0.000
1
6mer
17096-17119
0.000
1
AC004951.6
hsa-miR-34c-5p
0.997

Gene Details
Chromosome: 7
Transcript: ENST00000447643
Biotype: lincRNA
Gene id: ENSG00000228434
Gene Name: AC004951.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
44-69
0.086
1
6mer
1839-1857
0.020
1
KB-1592A4.14
hsa-miR-34c-5p
0.997

Gene Details
Chromosome: 22
Transcript: ENST00000417463
Biotype: lincRNA
Gene id: ENSG00000234503
Gene Name: KB-1592A4.14
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
51-72
0.099
2
6mer
615-631
0.007
1
LOC100128885
hsa-miR-34c-5p
0.997

Gene Details
Chromosome: 7
Transcript: NR_077227.1
Biotype: lincRNA
Gene id: NR_077227.1 (gene)
Gene Name: LOC100128885
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
213-231
0.039
2
8mer
4214-4234
0.031
1
6mer
141-162
0.015
2
6mer
986-1002
0.003
1
6mer
3626-3644
0.003
1
6mer
751-777
0.003
1
6mer
1159-1184
0.002
1
6mer
3256-3279
0.002
1
7mer
1294-1320
0.002
1
6mer
3028-3054
0.002
1
6mer
1237-1250
0.001
1
XLOC_001401
hsa-miR-34c-5p
0.996

Gene Details
Chromosome: chr2
Transcript: TCONS_00003609
Biotype: transcript isomorph
Gene id: XLOC_001401
Gene Name: XLOC_001401
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1947-1969
0.052
1
7mer
2203-2225
0.024
1
6mer
1866-1892
0.015
1
6mer
466-488
0.011
1
FAM224B
hsa-miR-34c-5p
0.996

Gene Details
Chromosome: Y
Transcript: ENST00000458667
Biotype: lincRNA
Gene id: ENSG00000230663
Gene Name: FAM224B
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1794-1820
0.088
1
6mer
1504-1524
0.011
1
FAM224A
hsa-miR-34c-5p
0.996

Gene Details
Chromosome: Y
Transcript: ENST00000419557
Biotype: lincRNA
Gene id: ENSG00000233522
Gene Name: FAM224A
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-34c-5p
Sequence: aggcaguguaguuagcugauugc
MirBase ID: MIMAT0000686
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
212-238
0.087
1
6mer
508-528
0.012
1
Funded by: