Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-375

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-375
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
224808-224833
0.008
2
7mer
68613-68629
0.007
3
7mer
189329-189354
0.007
3
7mer
249972-249993
0.007
1
7mer
81975-81988
0.006
6
7mer
249356-249379
0.006
1
7mer
132273-132295
0.006
9
7mer
9851-9860
0.006
7
7mer
203830-203852
0.006
1
7mer
118984-119001
0.005
6
7mer
159454-159479
0.005
4
7mer
50297-50308
0.005
2
6mer
127212-127237
0.005
13
7mer
102094-102115
0.004
2
7mer
47382-47405
0.004
2
7mer
198722-198746
0.004
1
7mer
230966-230992
0.004
1
7mer
224202-224226
0.004
1
6mer
266685-266709
0.004
2
7mer
3795-3816
0.004
2
7mer
187508-187517
0.003
Not Conserved
7mer
193170-193193
0.003
Not Conserved
7mer
209868-209883
0.003
2
7mer
3891-3900
0.003
6
6mer
73815-73830
0.003
8
6mer
99969-99986
0.003
8
7mer
7782-7804
0.003
2
6mer
163963-163978
0.003
6
6mer
22227-22253
0.003
8
6mer
173276-173289
0.003
5
6mer
179753-179767
0.003
7
7mer
148183-148205
0.003
4
6mer
93768-93793
0.002
7
6mer
67621-67643
0.002
2
6mer
194646-194669
0.002
2
6mer
89206-89224
0.002
2
6mer
167801-167827
0.002
2
6mer
36393-36417
0.002
2
6mer
146636-146663
0.002
1
7mer
135208-135228
0.002
2
7mer
224873-224897
0.002
1
6mer
229429-229433
0.002
Not Conserved
6mer
85828-85832
0.002
Not Conserved
6mer
234555-234559
0.002
Not Conserved
7mer
165206-165224
0.002
2
6mer
106572-106579
0.002
2
6mer
212936-212960
0.002
2
6mer
153685-153707
0.002
2
6mer
104715-104724
0.002
2
6mer
37546-37572
0.002
1
6mer
172452-172468
0.002
2
6mer
257196-257217
0.002
2
6mer
191208-191232
0.002
8
6mer
123474-123494
0.002
3
6mer
11736-11763
0.002
3
6mer
244330-244353
0.002
2
6mer
229110-229126
0.002
2
6mer
148441-148452
0.002
9
6mer
47805-47825
0.002
4
7mer
250094-250103
0.002
1
6mer
154442-154466
0.002
3
6mer
66511-66535
0.002
3
6mer
236714-236740
0.002
2
6mer
182314-182332
0.002
1
6mer
190949-190973
0.002
4
6mer
9098-9102
0.002
Not Conserved
6mer
182910-182928
0.002
2
6mer
50126-50144
0.002
1
6mer
231580-231597
0.002
1
6mer
30157-30171
0.002
3
6mer
64829-64844
0.002
1
6mer
188222-188242
0.002
2
7mer
250631-250646
0.002
1
6mer
68128-68145
0.002
2
6mer
8538-8565
0.002
3
6mer
53576-53598
0.002
2
6mer
232196-232221
0.002
1
6mer
46521-46547
0.002
2
6mer
225775-225795
0.002
1
6mer
193571-193597
0.002
Not Conserved
6mer
131492-131509
0.002
2
6mer
240351-240378
0.002
1
6mer
51402-51424
0.002
3
6mer
123591-123611
0.002
6
6mer
77412-77438
0.002
2
6mer
30798-30823
0.002
2
6mer
23964-23979
0.002
2
6mer
136775-136792
0.002
4
6mer
58765-58774
0.002
4
6mer
7039-7043
0.002
2
6mer
32732-32755
0.002
1
6mer
93004-93021
0.002
Not Conserved
6mer
102507-102532
0.002
3
6mer
196877-196897
0.002
2
6mer
160648-160669
0.002
2
6mer
147383-147392
0.002
1
6mer
92645-92662
0.002
2
6mer
40669-40691
0.002
2
6mer
148038-148065
0.002
1
6mer
81795-81818
0.002
1
6mer
187675-187692
0.002
2
6mer
161585-161601
0.002
3
6mer
92820-92829
0.002
1
6mer
248976-248991
0.001
1
6mer
141063-141086
0.001
2
6mer
250595-250616
0.001
1
6mer
197643-197665
0.001
2
6mer
28031-28056
0.001
2
6mer
17629-17646
0.001
2
6mer
221373-221392
0.001
2
6mer
223232-223252
0.001
2
6mer
230607-230634
0.001
1
6mer
234250-234270
0.001
1
6mer
261634-261658
0.001
2
6mer
72312-72330
0.001
2
6mer
199220-199234
0.001
1
6mer
191731-191746
0.001
1
6mer
160265-160291
0.001
2
6mer
138503-138529
0.001
Not Conserved
6mer
125775-125798
0.001
1
6mer
34249-34267
0.001
2
6mer
88620-88644
0.001
2
6mer
39289-39310
0.001
1
6mer
150408-150434
0.001
2
6mer
48056-48072
0.001
3
6mer
148305-148316
0.001
4
6mer
261852-261878
0.001
Not Conserved
6mer
230773-230791
0.001
1
6mer
186313-186339
0.001
1
6mer
258001-258012
0.001
2
6mer
260139-260157
0.001
1
6mer
11986-12009
0.001
1
6mer
69098-69122
0.001
1
6mer
50430-50452
0.001
1
6mer
186570-186591
0.001
1
6mer
82378-82401
0.001
1
6mer
96801-96827
0.001
2
6mer
84612-84634
0.001
1
6mer
52335-52354
0.001
1
6mer
242088-242114
0.001
1
6mer
244408-244434
0.001
2
6mer
3839-3862
0.001
5
6mer
253314-253329
0.001
Not Conserved
6mer
225786-225803
0.001
2
6mer
212958-212975
0.001
2
6mer
163964-163983
0.001
6
6mer
256714-256734
0.001
1
6mer
219370-219393
0.001
3
6mer
40172-40190
0.001
1
6mer
67624-67651
0.001
1
6mer
229449-229457
0.001
1
6mer
229429-229439
0.001
Not Conserved
6mer
39375-39397
0.001
2
6mer
123474-123500
0.001
2
6mer
230803-230829
0.001
1
6mer
250121-250148
0.001
1
6mer
125167-125183
0.001
2
6mer
193587-193607
0.001
1
6mer
260374-260390
0.001
1
6mer
135170-135191
0.001
2
6mer
11769-11789
0.001
1
6mer
229110-229131
0.001
2
6mer
236718-236745
0.001
1
6mer
182910-182934
0.001
1
KCNQ1OT1
hsa-miR-375
1.000

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
46953-46979
0.010
8
7mer
21778-21798
0.008
1
7mer
20937-20963
0.007
1
7mer
61810-61833
0.007
2
7mer
3453-3469
0.006
2
7mer
54556-54574
0.006
2
7mer
20710-20729
0.006
2
7mer
82745-82771
0.006
5
7mer
6512-6530
0.006
3
7mer
13596-13614
0.005
2
6mer
725-741
0.004
1
7mer
35934-35949
0.004
1
7mer
34391-34416
0.004
1
7mer
27528-27538
0.004
Not Conserved
8mer
31456-31481
0.004
1
6mer
44115-44142
0.003
7
9mer
30576-30595
0.003
1
7mer
45244-45262
0.003
2
7mer
27302-27315
0.003
1
7mer
29058-29083
0.003
1
7mer
30912-30930
0.003
1
6mer
667-675
0.003
2
6mer
60832-60846
0.003
3
6mer
637-658
0.002
2
6mer
20307-20326
0.002
2
6mer
66352-66376
0.002
6
7mer
39996-40014
0.002
1
6mer
87259-87285
0.002
6
6mer
8024-8043
0.002
2
6mer
21384-21394
0.002
2
6mer
55601-55619
0.002
2
6mer
49429-49456
0.002
2
6mer
40535-40562
0.002
2
6mer
40041-40067
0.002
1
6mer
88566-88583
0.002
2
6mer
25076-25089
0.002
2
6mer
15941-15959
0.002
2
6mer
1847-1870
0.002
2
6mer
81416-81435
0.002
3
6mer
33900-33922
0.002
1
6mer
33335-33349
0.002
1
6mer
8357-8371
0.002
2
6mer
8578-8603
0.002
2
6mer
51729-51753
0.002
2
6mer
2315-2337
0.002
2
6mer
9727-9753
0.002
2
6mer
12996-13014
0.002
2
6mer
74770-74790
0.002
3
6mer
2860-2880
0.002
1
6mer
75501-75526
0.002
5
6mer
41805-41824
0.002
2
6mer
11508-11517
0.002
2
6mer
88252-88276
0.002
2
6mer
36383-36408
0.002
1
6mer
4770-4791
0.002
3
6mer
12660-12685
0.002
1
6mer
7465-7469
0.002
2
6mer
28781-28807
0.002
1
6mer
6335-6357
0.002
2
6mer
63869-63878
0.002
1
6mer
24874-24890
0.002
2
6mer
38730-38755
0.002
1
6mer
14128-14150
0.002
2
6mer
22124-22145
0.002
2
6mer
14524-14547
0.002
2
6mer
30584-30604
0.002
1
6mer
26722-26737
0.002
1
6mer
71939-71960
0.002
2
6mer
22466-22489
0.002
2
6mer
26886-26906
0.002
1
6mer
27721-27742
0.002
1
6mer
38503-38527
0.002
1
6mer
29226-29251
0.002
1
6mer
23097-23101
0.002
Not Conserved
6mer
18833-18859
0.002
1
6mer
34885-34907
0.002
Not Conserved
6mer
18033-18056
0.002
2
6mer
54085-54107
0.002
2
6mer
50989-51009
0.002
2
6mer
7287-7299
0.002
2
6mer
21662-21688
0.002
2
6mer
35118-35138
0.002
1
6mer
13451-13477
0.002
2
6mer
18214-18239
0.002
2
6mer
21992-21996
0.002
1
6mer
21247-21272
0.002
2
6mer
29990-30003
0.001
1
6mer
1751-1772
0.001
2
6mer
69693-69711
0.001
1
6mer
87616-87638
0.001
2
6mer
83279-83294
0.001
2
6mer
19804-19825
0.001
2
6mer
51161-51183
0.001
2
6mer
7921-7948
0.001
2
6mer
10310-10324
0.001
2
6mer
13333-13353
0.001
2
6mer
69277-69296
0.001
1
6mer
50088-50110
0.001
1
6mer
25899-25918
0.001
1
6mer
4486-4506
0.001
2
6mer
2678-2704
0.001
Not Conserved
6mer
31233-31256
0.001
1
6mer
45707-45727
0.001
3
6mer
48842-48867
0.001
1
6mer
35654-35669
0.001
1
6mer
50075-50100
0.001
5
6mer
33741-33762
0.001
1
6mer
51562-51581
0.001
2
6mer
31556-31573
0.001
1
6mer
24748-24769
0.001
1
6mer
4577-4593
0.001
3
6mer
83142-83162
0.001
3
6mer
88447-88467
0.001
4
6mer
77566-77588
0.001
2
6mer
5142-5168
0.001
1
6mer
10236-10258
0.001
2
6mer
69649-69663
0.001
2
6mer
26066-26089
0.001
1
6mer
4673-4693
0.001
3
6mer
7894-7919
0.001
1
6mer
35568-35594
0.001
1
6mer
7064-7083
0.001
2
6mer
65062-65084
0.001
3
6mer
12619-12636
0.001
Not Conserved
6mer
7154-7176
0.001
Not Conserved
6mer
4691-4718
0.001
2
6mer
88559-88583
0.001
2
6mer
7875-7896
0.001
1
6mer
25070-25087
0.001
2
6mer
38668-38683
0.001
1
6mer
88553-88563
0.001
2
6mer
87536-87552
0.001
2
6mer
6295-6321
0.001
2
6mer
12614-12618
0.001
1
6mer
7111-7136
0.001
2
6mer
26704-26724
0.001
1
6mer
9669-9692
0.001
1
6mer
4439-4454
0.001
Not Conserved
6mer
87410-87430
0.001
Not Conserved
6mer
39613-39629
0.001
1
6mer
22114-22126
0.000
1
LINC00662
hsa-miR-375
1.000

Gene Details
Chromosome: 19
Transcript: ENST00000586954
Biotype: lincRNA
Gene id: ENSG00000261824
Gene Name: LINC00662
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
215-228
0.038
1
7mer
1246-1260
0.027
1
7mer
707-720
0.018
1
7mer
1407-1420
0.018
1
6mer
266-291
0.016
1
6mer
1995-2021
0.014
1
6mer
519-542
0.013
1
6mer
1491-1516
0.011
1
6mer
755-778
0.009
1
6mer
1459-1482
0.006
1
RP3-323A16.1
hsa-miR-375
0.999

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
25093-25116
0.008
2
7mer
37807-37827
0.006
4
7mer
24824-24842
0.006
2
7mer
1875-1886
0.005
1
7mer
26349-26369
0.005
2
7mer
53122-53141
0.005
Not Conserved
7mer
26729-26746
0.005
1
7mer
51648-51674
0.004
1
7mer
6163-6182
0.004
1
7mer
26522-26546
0.004
2
7mer
42506-42530
0.003
3
7mer
5830-5847
0.003
1
8mer
5276-5301
0.003
Not Conserved
6mer
28504-28531
0.002
Not Conserved
7mer
29164-29185
0.002
Not Conserved
6mer
23696-23706
0.002
3
6mer
7918-7944
0.002
1
6mer
9310-9335
0.002
3
6mer
23259-23281
0.002
2
6mer
29963-29976
0.002
2
6mer
20514-20540
0.002
2
6mer
25934-25959
0.002
2
6mer
38264-38274
0.002
2
6mer
26230-26253
0.002
2
6mer
26969-26986
0.002
1
7mer
7643-7668
0.002
1
6mer
39390-39409
0.002
2
6mer
7016-7036
0.002
1
6mer
2039-2060
0.002
2
6mer
7478-7503
0.002
1
6mer
6715-6728
0.002
1
6mer
45040-45054
0.002
1
6mer
51211-51238
0.002
3
6mer
27185-27195
0.001
1
6mer
43252-43266
0.001
2
6mer
8387-8404
0.001
Not Conserved
6mer
21450-21468
0.001
2
6mer
29748-29773
0.001
1
6mer
21165-21178
0.001
2
6mer
36819-36843
0.001
1
6mer
31292-31315
0.001
1
6mer
11080-11106
0.001
2
6mer
14995-15018
0.001
1
6mer
21315-21336
0.001
2
6mer
44842-44858
0.001
1
6mer
26779-26791
0.001
2
6mer
3360-3385
0.001
2
6mer
27336-27354
0.001
2
6mer
5184-5201
0.001
1
6mer
23745-23769
0.001
1
6mer
27230-27251
0.001
2
6mer
27423-27436
0.001
2
6mer
28619-28637
0.001
2
6mer
28541-28545
0.001
1
6mer
28549-28553
0.001
1
6mer
31914-31927
0.001
1
6mer
28534-28538
0.001
Not Conserved
6mer
26373-26385
0.001
2
6mer
42562-42584
0.001
2
6mer
23696-23719
0.001
1
6mer
7574-7589
0.001
1
6mer
28549-28559
0.000
1
6mer
2063-2084
0.000
Not Conserved
6mer
43252-43275
0.000
2
MIR6818
hsa-miR-375
0.999

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
17761-17772
0.008
Not Conserved
7mer
12024-12037
0.007
5
6mer
48739-48759
0.006
12
7mer
38256-38274
0.005
5
7mer
31802-31816
0.005
2
7mer
23252-23266
0.004
2
7mer
43921-43946
0.004
1
7mer
22882-22907
0.004
2
6mer
43066-43092
0.004
12
7mer
27993-28010
0.003
1
7mer
12365-12383
0.003
1
7mer
29101-29126
0.003
2
7mer
45593-45607
0.003
2
6mer
5323-5337
0.003
6
6mer
13939-13955
0.002
4
6mer
29981-29995
0.002
5
6mer
14558-14582
0.002
5
6mer
27609-27635
0.002
1
6mer
8423-8438
0.002
2
6mer
12384-12402
0.002
5
6mer
10285-10311
0.002
1
6mer
10644-10668
0.002
1
6mer
13138-13163
0.002
1
6mer
17775-17797
0.002
1
6mer
9422-9439
0.002
2
6mer
18937-18963
0.002
1
6mer
29416-29437
0.002
2
6mer
6641-6659
0.002
2
6mer
7724-7751
0.002
Not Conserved
6mer
33737-33754
0.002
1
6mer
19740-19762
0.002
4
6mer
45752-45766
0.002
2
6mer
29708-29728
0.002
3
7mer
7675-7692
0.002
2
6mer
33291-33304
0.001
2
6mer
36504-36529
0.001
1
6mer
28150-28172
0.001
3
7mer
29636-29658
0.001
2
6mer
46657-46673
0.001
2
6mer
35189-35210
0.001
1
6mer
13873-13898
0.001
4
7mer
13828-13846
0.001
2
6mer
4375-4399
0.001
1
6mer
40356-40380
0.001
1
6mer
8815-8836
0.001
3
6mer
18872-18895
0.001
3
6mer
7551-7576
0.001
Not Conserved
6mer
37078-37095
0.001
2
6mer
46530-46549
0.001
3
6mer
10275-10292
0.001
1
6mer
9300-9324
0.001
3
6mer
8368-8394
0.001
2
6mer
36308-36332
0.001
1
6mer
13131-13155
0.001
1
6mer
17770-17797
0.001
1
6mer
13820-13846
0.001
1
FLJ26245
hsa-miR-375
0.999

Gene Details
Chromosome: 16
Transcript: ENST00000566900
Biotype: lincRNA
Gene id: ENSG00000261122
Gene Name: FLJ26245
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1225-1242
0.049
1
7mer
539-559
0.041
1
6mer
1393-1413
0.016
1
6mer
882-902
0.010
1
6mer
713-730
0.008
1
RP11-216M21.7
hsa-miR-375
0.999

Gene Details
Chromosome: 9
Transcript: ENST00000450520
Biotype: lincRNA
Gene id: ENSG00000233207
Gene Name: RP11-216M21.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2323-2347
0.121
1
RP3-399L15.3
hsa-miR-375
0.998

Gene Details
Chromosome: 6
Transcript: ENST00000519104
Biotype: antisense
Gene id: ENSG00000228624
Gene Name: RP3-399L15.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
215-240
0.092
9
8mer
438-462
0.012
3
6mer
234-250
0.008
9
6mer
1651-1675
0.004
1
ERVK3-1
hsa-miR-375
0.998

Gene Details
Chromosome: 19
Transcript: ENST00000590505
Biotype: retained_intron
Gene id: ENSG00000142396
Gene Name: ERVK3-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3713-3733
0.060
2
7mer
384-400
0.024
1
6mer
3498-3516
0.015
2
6mer
3253-3280
0.004
1
6mer
2880-2898
0.004
1
6mer
2909-2935
0.003
1
6mer
2408-2429
0.003
1
SNORD116-20
hsa-miR-375
0.997

Gene Details
Chromosome: 15
Transcript: ENST00000567527
Biotype: lincRNA
Gene id: ENSG00000261069
Gene Name: SNORD116-20
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1175-1190
0.064
4
7mer
33-48
0.040
3
RP11-118E18.2
hsa-miR-375
0.994

Gene Details
Chromosome: 17
Transcript: ENST00000577189
Biotype: antisense
Gene id: ENSG00000266100
Gene Name: RP11-118E18.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
74-85
0.051
9
7mer
180-206
0.043
9
XLOC_001668
hsa-miR-375
0.993

Gene Details
Chromosome: chr2
Transcript: TCONS_00003870
Biotype: transcript isomorph
Gene id: XLOC_001668
Gene Name: XLOC_001668
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5053-5071
0.028
2
7mer
4064-4083
0.020
2
7mer
3319-3328
0.015
2
6mer
5936-5952
0.007
1
6mer
745-760
0.006
1
6mer
2995-3022
0.006
2
6mer
3655-3678
0.005
2
6mer
4157-4183
0.004
2
6mer
3029-3033
0.001
1
LSAMP-AS1
hsa-miR-375
0.992

Gene Details
Chromosome: 3
Transcript: ENST00000490351
Biotype: antisense
Gene id: ENSG00000240922
Gene Name: LSAMP-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
543-551
0.089
1
DGCR5
hsa-miR-375
0.991

Gene Details
Chromosome: 22
Transcript: ENST00000424407
Biotype: antisense
Gene id: ENSG00000237517
Gene Name: DGCR5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
542-562
0.050
1
6mer
202-214
0.016
1
6mer
205-209
0.016
1
6mer
200-204
0.006
Not Conserved
CTC-499B15.7
hsa-miR-375
0.991

Gene Details
Chromosome: 19
Transcript: ENST00000589227
Biotype: antisense
Gene id: ENSG00000267646
Gene Name: CTC-499B15.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
212-226
0.021
1
7mer
539-554
0.019
1
7mer
393-417
0.017
1
6mer
269-294
0.007
1
6mer
441-465
0.006
1
6mer
337-361
0.005
1
6mer
871-893
0.005
1
6mer
388-411
0.004
1
6mer
359-379
0.004
1
RP11-1437A8.4
hsa-miR-375
0.989

Gene Details
Chromosome: 16
Transcript: ENST00000563960
Biotype: lincRNA
Gene id: ENSG00000260827
Gene Name: RP11-1437A8.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1921-1944
0.035
1
7mer
1290-1312
0.024
1
6mer
69-89
0.013
1
6mer
612-637
0.012
1
AC006548.28
hsa-miR-375
0.989

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
36659-36683
0.005
Not Conserved
7mer
40275-40298
0.005
2
7mer
59065-59083
0.003
2
6mer
61481-61504
0.003
2
7mer
48008-48021
0.003
Not Conserved
7mer
44769-44794
0.002
2
6mer
84011-84030
0.002
1
6mer
4563-4587
0.002
3
6mer
2635-2648
0.002
2
6mer
72824-72844
0.002
1
6mer
80634-80652
0.002
2
6mer
35379-35393
0.002
3
6mer
2144-2171
0.002
2
6mer
4358-4381
0.002
2
6mer
42928-42951
0.002
2
6mer
37563-37589
0.002
4
6mer
80835-80845
0.002
2
6mer
39124-39149
0.002
2
6mer
47423-47438
0.002
Not Conserved
6mer
44863-44883
0.002
2
6mer
80457-80484
0.002
1
6mer
4885-4908
0.002
3
6mer
70780-70792
0.002
1
6mer
50388-50408
0.002
Not Conserved
6mer
24121-24147
0.002
1
6mer
42126-42141
0.002
1
6mer
37991-38008
0.002
1
6mer
68142-68159
0.002
1
6mer
9890-9905
0.001
2
6mer
18983-18995
0.001
Not Conserved
6mer
62014-62034
0.001
1
6mer
49925-49940
0.001
Not Conserved
6mer
69274-69293
0.001
Not Conserved
6mer
50110-50132
0.001
Not Conserved
6mer
19792-19811
0.001
2
6mer
46791-46807
0.001
Not Conserved
6mer
7239-7265
0.001
2
6mer
46633-46652
0.001
Not Conserved
7mer
49759-49784
0.001
Not Conserved
6mer
69076-69095
0.001
1
6mer
51909-51931
0.001
Not Conserved
6mer
45062-45076
0.001
2
6mer
61941-61965
0.001
2
6mer
69020-69042
0.001
1
6mer
51749-51766
0.001
Not Conserved
6mer
49838-49862
0.001
Not Conserved
6mer
47951-47970
0.001
Not Conserved
6mer
49804-49825
0.001
Not Conserved
XLOC_010695
hsa-miR-375
0.989

Gene Details
Chromosome: chr13
Transcript: TCONS_00022087
Biotype: transcript isomorph
Gene id: XLOC_010695
Gene Name: XLOC_010695
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
Fibroblasts Lung Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1268-1291
0.038
15
7mer
870-891
0.037
14
6mer
816-837
0.009
15
RP11-475A13.1
hsa-miR-375
0.986

Gene Details
Chromosome: 15
Transcript: ENST00000558963
Biotype: lincRNA
Gene id: ENSG00000259737
Gene Name: RP11-475A13.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
434-461
0.040
10
6mer
404-426
0.012
10
6mer
298-311
0.010
9
6mer
278-299
0.010
9
6mer
705-718
0.005
4
6mer
2449-2471
0.005
2
XLOC_012370
hsa-miR-375
0.986

Gene Details
Chromosome: chr17
Transcript: TCONS_00025543
Biotype: transcript isomorph
Gene id: XLOC_012370
Gene Name: XLOC_012370
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-375
Sequence: uuuguucguucggcucgcguga
MirBase ID: MIMAT0000728
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
694-719
0.033
1
7mer
931-952
0.033
1
6mer
367-381
0.015
1
Funded by: