Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-455-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_002079
hsa-miR-455-3p
1.000

Gene Details
Chromosome: chr2
Transcript: TCONS_00005139
Biotype: transcript isomorph
Gene id: XLOC_002079
Gene Name: XLOC_002079
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1444-1454
0.015
2
8mer
1494-1504
0.015
2
8mer
1274-1284
0.013
2
8mer
1348-1364
0.013
2
8mer
1469-1484
0.011
1
8mer
540-546
0.010
2
8mer
1152-1162
0.010
2
8mer
1372-1388
0.010
1
8mer
1299-1309
0.008
1
8mer
1324-1340
0.008
1
8mer
515-521
0.008
2
8mer
710-716
0.008
2
8mer
1249-1259
0.008
1
8mer
1103-1119
0.007
2
8mer
980-986
0.007
2
8mer
1201-1217
0.007
1
8mer
734-745
0.007
2
8mer
1177-1193
0.006
1
8mer
612-628
0.006
1
8mer
955-961
0.005
1
8mer
906-912
0.005
2
6mer
1518-1535
0.005
2
8mer
1005-1024
0.005
1
8mer
1054-1070
0.005
1
8mer
832-838
0.004
1
8mer
857-873
0.004
1
7mer
685-702
0.004
2
8mer
759-765
0.004
1
8mer
931-937
0.004
1
8mer
808-824
0.003
Not Conserved
6mer
661-677
0.002
1
chr22-38_28785274-29006793.1
hsa-miR-455-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
226818-226836
0.010
1
8mer
130568-130591
0.009
4
7mer
16301-16325
0.006
2
8mer
23972-23992
0.005
1
7mer
179810-179821
0.005
4
7mer
248766-248786
0.004
1
7mer
120469-120493
0.003
5
7mer
40881-40904
0.003
2
7mer
196046-196072
0.003
2
6mer
235520-235546
0.003
3
7mer
33582-33606
0.002
3
6mer
149905-149913
0.002
9
8mer
252093-252104
0.002
1
7mer
169478-169490
0.002
1
7mer
204079-204097
0.002
Not Conserved
6mer
163485-163496
0.002
7
6mer
36092-36106
0.002
2
7mer
62667-62690
0.002
2
7mer
30338-30348
0.002
2
6mer
119593-119618
0.002
9
6mer
172401-172419
0.002
1
7mer
184488-184510
0.002
1
7mer
30019-30032
0.002
3
6mer
5333-5343
0.002
4
7mer
241904-241922
0.002
1
6mer
183728-183737
0.002
2
6mer
9904-9911
0.002
4
6mer
57903-57920
0.002
Not Conserved
6mer
11797-11804
0.002
1
6mer
128924-128950
0.002
3
6mer
93754-93769
0.002
4
7mer
74768-74788
0.002
2
6mer
69727-69736
0.002
2
6mer
119675-119693
0.002
9
6mer
92214-92218
0.002
2
6mer
38522-38536
0.002
3
6mer
11409-11430
0.002
1
7mer
206014-206023
0.002
Not Conserved
7mer
43259-43276
0.001
2
6mer
218577-218590
0.001
2
6mer
204479-204489
0.001
2
7mer
93270-93285
0.001
4
6mer
95884-95897
0.001
3
6mer
21624-21640
0.001
2
6mer
168773-168791
0.001
2
6mer
7134-7152
0.001
2
6mer
160746-160757
0.001
4
6mer
220035-220048
0.001
1
6mer
196619-196637
0.001
3
6mer
181029-181047
0.001
1
6mer
57128-57146
0.001
2
6mer
12123-12136
0.001
1
6mer
128136-128154
0.001
2
6mer
6582-6591
0.001
2
6mer
93179-93204
0.001
4
7mer
125377-125397
0.001
1
6mer
21270-21279
0.001
1
6mer
72045-72065
0.001
Not Conserved
6mer
39054-39066
0.001
3
6mer
81190-81215
0.001
6
7mer
214187-214214
0.001
2
6mer
252249-252259
0.001
1
6mer
16528-16552
0.001
3
6mer
237791-237801
0.001
2
6mer
46198-46222
0.001
2
6mer
239503-239529
0.001
2
6mer
188698-188709
0.001
2
6mer
215104-215120
0.001
1
6mer
224427-224441
0.001
Not Conserved
6mer
117951-117977
0.001
2
6mer
57183-57202
0.001
2
6mer
94536-94547
0.001
2
6mer
259231-259247
0.001
2
6mer
205355-205372
0.001
1
7mer
120500-120518
0.001
3
6mer
68674-68682
0.001
1
6mer
7168-7188
0.000
2
RP11-76P2.4
hsa-miR-455-3p
0.995

Gene Details
Chromosome: 10
Transcript: ENST00000609123
Biotype: antisense
Gene id: ENSG00000273450
Gene Name: RP11-76P2.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-50
0.058
4
9mer
108-123
0.027
1
8mer
343-354
0.013
2
XLOC_011484
hsa-miR-455-3p
0.995

Gene Details
Chromosome: chr15
Transcript: TCONS_00023685
Biotype: transcript isomorph
Gene id: XLOC_011484
Gene Name: XLOC_011484
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2582-2600
0.037
1
7mer
2838-2853
0.018
1
8mer
3317-3335
0.013
Not Conserved
6mer
3170-3187
0.011
1
6mer
2316-2339
0.007
1
6mer
2106-2118
0.005
1
6mer
1592-1603
0.005
1
LCMT1-AS2
hsa-miR-455-3p
0.994

Gene Details
Chromosome: 16
Transcript: ENST00000565214
Biotype: antisense
Gene id: ENSG00000260034
Gene Name: LCMT1-AS2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4834-4849
0.036
2
7mer
4562-4583
0.022
2
6mer
5398-5417
0.017
2
8mer
1740-1763
0.011
1
6mer
1538-1554
0.004
2
6mer
3493-3503
0.003
1
RP11-854K16.3
hsa-miR-455-3p
0.993

Gene Details
Chromosome: 15
Transcript: ENST00000568414
Biotype: lincRNA
Gene id: ENSG00000260986
Gene Name: RP11-854K16.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
115-124
0.070
1
6mer
160-175
0.022
1
MAMDC2-AS1
hsa-miR-455-3p
0.991

Gene Details
Chromosome: 9
Transcript: ENST00000377178
Biotype: antisense
Gene id: ENSG00000204706
Gene Name: MAMDC2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
467-476
0.030
1
7mer
178-189
0.028
2
8mer
1180-1196
0.017
2
8mer
1366-1387
0.012
3
RP11-363N22.3
hsa-miR-455-3p
0.987

Gene Details
Chromosome: 10
Transcript: ENST00000381466
Biotype: antisense
Gene id: ENSG00000205740
Gene Name: RP11-363N22.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
372-392
0.076
2
7mer
1332-1347
0.005
2
ERVH48-1
hsa-miR-455-3p
0.986

Gene Details
Chromosome: 21
Transcript: ENST00000617971
Biotype: lincRNA
Gene id: ENSG00000233056
Gene Name: ERVH48-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1013-1036
0.042
1
9mer
771-785
0.039
1
RP11-344E13.3
hsa-miR-455-3p
0.980

Gene Details
Chromosome: 17
Transcript: ENST00000579168
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
608-626
0.074
1
RP11-44F14.8
hsa-miR-455-3p
0.980

Gene Details
Chromosome: 16
Transcript: ENST00000571340
Biotype: lincRNA
Gene id: ENSG00000262714
Gene Name: RP11-44F14.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
472-486
0.074
2
FAM224A
hsa-miR-455-3p
0.979

Gene Details
Chromosome: Y
Transcript: NR_002161.1
Biotype: lincRNA
Gene id: NR_002161.1 (gene)
Gene Name: FAM224A
UCSC graphic: -
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
350-368
0.074
1
RP11-16P6.1
hsa-miR-455-3p
0.973

Gene Details
Chromosome: 2
Transcript: ENST00000568928
Biotype: antisense
Gene id: ENSG00000261428
Gene Name: RP11-16P6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
338-355
0.069
2
MEG9
hsa-miR-455-3p
0.966

Gene Details
Chromosome: 14
Transcript: ENST00000452349
Biotype: lincRNA
Gene id: ENSG00000223403
Gene Name: MEG9
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
144-170
0.066
9
KCNQ1OT1
hsa-miR-455-3p
0.964

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
21010-21026
0.015
2
8mer
15918-15932
0.011
1
7mer
63895-63906
0.006
Not Conserved
7mer
78707-78722
0.004
3
8mer
55342-55363
0.003
2
6mer
65424-65439
0.002
3
6mer
20128-20148
0.002
2
7mer
64095-64110
0.002
1
6mer
76906-76919
0.002
3
6mer
23263-23275
0.002
2
7mer
36949-36965
0.002
1
6mer
60056-60075
0.002
3
6mer
73467-73493
0.002
2
6mer
59579-59594
0.001
2
6mer
75984-76000
0.001
2
6mer
37458-37480
0.001
1
6mer
54144-54153
0.001
2
6mer
88032-88056
0.001
2
6mer
64464-64481
0.001
2
6mer
3331-3340
0.001
2
6mer
77400-77417
0.001
1
6mer
36589-36599
0.001
1
RP11-344E13.3
hsa-miR-455-3p
0.958

Gene Details
Chromosome: 17
Transcript: ENST00000433763
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
554-572
0.062
1
RP11-356O9.1
hsa-miR-455-3p
0.957

Gene Details
Chromosome: 14
Transcript: ENST00000554829
Biotype: lincRNA
Gene id: ENSG00000258414
Gene Name: RP11-356O9.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
284-310
0.030
3
7mer
639-656
0.018
5
7mer
92-110
0.014
5
XLOC_003787
hsa-miR-455-3p
0.956

Gene Details
Chromosome: chr4
Transcript: TCONS_00008337
Biotype: transcript isomorph
Gene id: XLOC_003787
Gene Name: XLOC_003787
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Colon Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
490-504
0.032
2
8mer
521-538
0.029
2
ERVH48-1
hsa-miR-455-3p
0.955

Gene Details
Chromosome: 21
Transcript: ENST00000447535
Biotype: lincRNA
Gene id: ENSG00000233056
Gene Name: ERVH48-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1460-1483
0.033
1
9mer
1218-1232
0.028
1
RP3-340N1.2
hsa-miR-455-3p
0.953

Gene Details
Chromosome: 1
Transcript: ENST00000431027
Biotype: lincRNA
Gene id: ENSG00000227066
Gene Name: RP3-340N1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-455-3p
Sequence: gcaguccaugggcauauacac
MirBase ID: MIMAT0004784
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2075-2087
0.031
2
8mer
1476-1491
0.029
2
Funded by: