Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-548h-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-548h-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
183334-183353
0.011
5
9mer
11226-11252
0.011
2
9mer
91995-92002
0.010
2
8mer
178751-178768
0.009
2
8mer
89911-89934
0.009
2
8mer
77023-77040
0.007
3
7mer
176996-177021
0.007
Not Conserved
9mer
69736-69756
0.006
2
8mer
44099-44116
0.006
1
7mer
151642-151657
0.006
5
7mer
144720-144739
0.005
6
8mer
48790-48809
0.005
3
7mer
78225-78250
0.005
4
7mer
1217-1241
0.005
5
8mer
123020-123040
0.005
2
6mer
149250-149275
0.005
10
7mer
216534-216553
0.005
9
9mer
23026-23046
0.005
Not Conserved
7mer
145240-145256
0.004
3
8mer
64809-64835
0.004
Not Conserved
7mer
15486-15508
0.004
2
7mer
94762-94779
0.004
2
7mer
177638-177652
0.004
1
7mer
127334-127360
0.004
2
7mer
138545-138562
0.004
Not Conserved
7mer
38975-38995
0.004
6
7mer
224106-224131
0.003
1
7mer
68494-68516
0.003
1
7mer
171678-171700
0.003
2
8mer
56770-56788
0.003
2
7mer
170445-170450
0.003
1
7mer
205043-205064
0.003
3
7mer
266378-266391
0.003
1
6mer
21993-22014
0.003
9
6mer
58562-58579
0.003
4
7mer
140618-140629
0.003
2
6mer
261163-261167
0.003
2
6mer
71252-71275
0.003
1
6mer
149470-149491
0.003
6
7mer
205233-205254
0.003
2
7mer
169064-169084
0.003
2
6mer
19588-19597
0.003
2
6mer
17529-17547
0.003
2
6mer
127546-127570
0.003
3
7mer
10856-10883
0.003
2
7mer
168978-169004
0.002
2
6mer
152740-152751
0.002
2
6mer
201204-201227
0.002
Not Conserved
6mer
164220-164244
0.002
2
7mer
124422-124448
0.002
3
6mer
35894-35915
0.002
5
7mer
113432-113447
0.002
1
6mer
20883-20902
0.002
5
6mer
172337-172359
0.002
3
6mer
123783-123800
0.002
8
6mer
175022-175036
0.002
1
6mer
220353-220362
0.002
1
6mer
172889-172914
0.002
5
6mer
198147-198162
0.002
1
6mer
19840-19858
0.002
2
7mer
216559-216583
0.002
2
7mer
202325-202340
0.002
Not Conserved
6mer
57767-57788
0.002
3
6mer
145372-145394
0.002
5
6mer
78989-79012
0.002
2
6mer
193802-193820
0.002
1
7mer
28641-28667
0.002
2
7mer
43190-43202
0.002
2
6mer
3882-3908
0.002
7
6mer
243968-243994
0.002
1
6mer
156915-156933
0.002
1
6mer
158802-158814
0.002
3
7mer
159180-159200
0.002
3
6mer
220526-220544
0.002
2
6mer
79682-79699
0.002
1
8mer
57792-57813
0.002
2
6mer
2189-2207
0.002
6
6mer
33757-33777
0.002
3
6mer
229702-229716
0.002
1
6mer
42161-42176
0.002
4
6mer
98581-98596
0.002
4
7mer
67432-67448
0.002
3
7mer
76156-76183
0.002
1
6mer
15977-15992
0.002
1
6mer
29787-29800
0.002
2
6mer
166656-166671
0.002
3
6mer
45872-45891
0.002
3
6mer
165221-165240
0.002
4
6mer
44845-44864
0.002
1
6mer
45536-45558
0.002
2
7mer
57828-57846
0.002
3
6mer
236790-236808
0.002
2
6mer
51813-51833
0.002
2
6mer
107388-107409
0.002
3
6mer
25420-25443
0.002
2
6mer
31413-31438
0.002
2
6mer
130692-130713
0.002
2
6mer
116767-116793
0.002
2
6mer
63390-63404
0.002
2
6mer
55326-55345
0.002
1
6mer
203093-203106
0.002
Not Conserved
6mer
147743-147767
0.002
3
7mer
159300-159317
0.002
2
6mer
14123-14139
0.002
1
6mer
177338-177363
0.002
2
6mer
147599-147616
0.002
2
6mer
232735-232752
0.002
2
6mer
173801-173825
0.002
2
7mer
122928-122944
0.002
1
6mer
215004-215026
0.002
1
6mer
187850-187874
0.002
1
6mer
109805-109818
0.002
Not Conserved
6mer
175534-175558
0.001
2
6mer
12738-12750
0.001
2
6mer
264036-264061
0.001
2
6mer
158536-158553
0.001
2
6mer
102201-102221
0.001
2
6mer
8351-8375
0.001
2
6mer
251913-251936
0.001
1
6mer
261766-261792
0.001
Not Conserved
6mer
116862-116888
0.001
2
6mer
251686-251712
0.001
1
6mer
133413-133429
0.001
1
6mer
237266-237273
0.001
1
6mer
153126-153151
0.001
2
6mer
92394-92420
0.001
1
6mer
183664-183687
0.001
1
6mer
184015-184040
0.001
1
6mer
6088-6107
0.001
1
6mer
95825-95838
0.001
1
6mer
205106-205131
0.001
2
6mer
78318-78328
0.001
2
6mer
155903-155923
0.001
Not Conserved
7mer
98587-98605
0.001
1
6mer
166864-166884
0.001
2
6mer
166692-166718
0.001
3
6mer
44921-44935
0.001
1
6mer
155936-155947
0.001
5
6mer
166754-166775
0.001
2
6mer
8395-8414
0.000
Not Conserved
LCMT1-AS2
hsa-miR-548h-5p
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000565214
Biotype: antisense
Gene id: ENSG00000260034
Gene Name: LCMT1-AS2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5536-5552
0.042
2
9mer
616-637
0.042
2
8mer
3997-4017
0.037
2
6mer
1428-1447
0.009
2
7mer
2075-2096
0.009
2
7mer
2185-2208
0.008
2
6mer
1733-1753
0.006
2
6mer
4758-4772
0.005
1
7mer
2987-2999
0.004
1
LOC100190986
hsa-miR-548h-5p
1.000

Gene Details
Chromosome: 16
Transcript: NR_024456.1
Biotype: sense
Gene id: NR_024456.1 (gene)
Gene Name: LOC100190986
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2144-2164
0.050
1
8mer
1973-1994
0.036
1
7mer
917-937
0.034
1
6mer
845-868
0.010
1
6mer
1142-1155
0.010
1
XLOC_012784
hsa-miR-548h-5p
0.999

Gene Details
Chromosome: chr18
Transcript: TCONS_00026436
Biotype: transcript isomorph
Gene id: XLOC_012784
Gene Name: XLOC_012784
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HREpiC Kidney Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
242-255
0.041
1
7mer
37-57
0.037
1
6mer
169-190
0.019
1
7mer
2100-2118
0.011
Not Conserved
6mer
1225-1236
0.010
1
XLOC_009222
hsa-miR-548h-5p
0.998

Gene Details
Chromosome: chr11
Transcript: TCONS_00019399
Biotype: transcript isomorph
Gene id: XLOC_009222
Gene Name: XLOC_009222
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
230-253
0.047
1
7mer
5997-6013
0.022
1
8mer
2249-2272
0.019
1
6mer
5363-5376
0.018
1
6mer
2610-2628
0.008
1
RP11-363G2.4
hsa-miR-548h-5p
0.997

Gene Details
Chromosome: 13
Transcript: ENST00000445646
Biotype: lincRNA
Gene id: ENSG00000229556
Gene Name: RP11-363G2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1706-1725
0.056
1
7mer
1806-1824
0.034
1
6mer
384-402
0.017
1
AC006548.28
hsa-miR-548h-5p
0.994

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
113-126
0.008
2
7mer
592-619
0.006
2
7mer
71174-71196
0.006
1
8mer
55344-55365
0.005
1
8mer
31151-31175
0.004
1
8mer
21467-21487
0.004
2
7mer
4457-4478
0.004
3
7mer
3234-3253
0.004
2
7mer
2245-2264
0.004
2
6mer
1488-1508
0.002
2
8mer
23274-23280
0.002
2
6mer
41049-41072
0.002
2
6mer
48071-48092
0.002
Not Conserved
6mer
21119-21123
0.002
1
6mer
30408-30429
0.002
2
6mer
1265-1287
0.002
2
6mer
16542-16566
0.002
2
6mer
59468-59487
0.002
2
6mer
8762-8766
0.002
1
7mer
8394-8411
0.002
1
6mer
22286-22310
0.002
2
6mer
79525-79544
0.002
Not Conserved
7mer
20631-20653
0.002
2
6mer
67452-67469
0.002
Not Conserved
6mer
56257-56278
0.002
1
6mer
73955-73979
0.002
2
6mer
36503-36523
0.002
2
6mer
65841-65864
0.002
1
6mer
16953-16964
0.001
1
6mer
63819-63837
0.001
2
6mer
75104-75130
0.001
1
6mer
20744-20767
0.001
2
6mer
23288-23303
0.001
1
6mer
67922-67943
0.001
Not Conserved
6mer
51926-51952
0.001
Not Conserved
6mer
62927-62951
0.001
2
6mer
31143-31155
0.001
2
6mer
14176-14197
0.001
1
6mer
2176-2196
0.001
2
6mer
8347-8359
0.001
Not Conserved
TTTY5
hsa-miR-548h-5p
0.994

Gene Details
Chromosome: Y
Transcript: ENST00000400581
Biotype: lincRNA
Gene id: ENSG00000215560
Gene Name: TTTY5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
121-143
0.052
1
7mer
113-139
0.022
1
6mer
1465-1487
0.019
1
XLOC_008330
hsa-miR-548h-5p
0.993

Gene Details
Chromosome: chrY
Transcript: TCONS_00017593
Biotype: transcript isomorph
Gene id: XLOC_008330
Gene Name: XLOC_008330
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
120-142
0.052
1
7mer
112-138
0.022
1
6mer
1464-1486
0.019
1
CTB-89H12.4
hsa-miR-548h-5p
0.993

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
144-169
0.015
7
7mer
709-732
0.011
10
7mer
8462-8473
0.010
2
6mer
534-551
0.009
11
6mer
559-576
0.009
11
7mer
8595-8622
0.009
1
7mer
8291-8312
0.008
5
6mer
886-896
0.005
5
7mer
4224-4247
0.005
1
6mer
5416-5439
0.004
7
7mer
1285-1311
0.004
1
7mer
2678-2697
0.003
2
6mer
4184-4202
0.001
2
XLOC_013010
hsa-miR-548h-5p
0.993

Gene Details
Chromosome: chr19
Transcript: TCONS_00026952
Biotype: transcript isomorph
Gene id: XLOC_013010
Gene Name: XLOC_013010
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
33-58
0.039
1
6mer
1610-1625
0.016
1
6mer
1541-1558
0.015
1
6mer
794-817
0.012
1
6mer
86-103
0.005
Not Conserved
6mer
1576-1592
0.004
Not Conserved
LINC00665
hsa-miR-548h-5p
0.993

Gene Details
Chromosome: 19
Transcript: ENST00000427868
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
199-217
0.060
2
7mer
3-27
0.032
2
RP11-395P13.1
hsa-miR-548h-5p
0.993

Gene Details
Chromosome: 5
Transcript: ENST00000511994
Biotype: lincRNA
Gene id: ENSG00000248147
Gene Name: RP11-395P13.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
524-544
0.091
11
TSIX
hsa-miR-548h-5p
0.992

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
8988-9008
0.011
2
8mer
28513-28538
0.009
2
6mer
36424-36449
0.005
3
7mer
28828-28852
0.005
5
7mer
29278-29294
0.005
2
7mer
24676-24698
0.004
2
6mer
35985-36011
0.004
3
7mer
15031-15036
0.003
Not Conserved
6mer
20657-20679
0.003
4
7mer
22480-22498
0.003
1
6mer
23870-23885
0.003
3
6mer
32095-32109
0.003
3
6mer
33132-33154
0.003
3
6mer
25812-25823
0.003
4
7mer
32875-32886
0.002
1
6mer
34028-34043
0.002
5
6mer
5838-5863
0.002
3
6mer
21988-22002
0.002
2
6mer
19055-19066
0.002
2
6mer
19896-19915
0.002
4
6mer
19804-19817
0.002
1
6mer
21389-21406
0.002
1
6mer
23145-23155
0.002
1
6mer
27895-27907
0.002
2
6mer
30328-30354
0.002
2
6mer
3821-3841
0.002
1
6mer
10090-10106
0.001
Not Conserved
6mer
18208-18228
0.001
1
6mer
22853-22870
0.001
2
RP11-96K19.4
hsa-miR-548h-5p
0.992

Gene Details
Chromosome: 1
Transcript: ENST00000562952
Biotype: sense_overlapping
Gene id: ENSG00000261654
Gene Name: RP11-96K19.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2566-2590
0.028
2
6mer
68-85
0.024
2
7mer
4775-4780
0.013
1
7mer
2117-2122
0.008
2
6mer
3078-3101
0.006
2
6mer
1699-1722
0.004
1
6mer
3469-3490
0.003
1
6mer
4767-4771
0.002
1
6mer
3028-3053
0.001
Not Conserved
XLOC_012755
hsa-miR-548h-5p
0.992

Gene Details
Chromosome: chr18
Transcript: TCONS_00026408
Biotype: transcript isomorph
Gene id: XLOC_012755
Gene Name: XLOC_012755
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
89-111
0.064
1
6mer
73-87
0.025
1
XLOC_010279
hsa-miR-548h-5p
0.992

Gene Details
Chromosome: chr12
Transcript: TCONS_00020261
Biotype: transcript isomorph
Gene id: XLOC_010279
Gene Name: XLOC_010279
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
114-139
0.075
1
6mer
544-561
0.014
1
XLOC_001583
hsa-miR-548h-5p
0.992

Gene Details
Chromosome: chr2
Transcript: TCONS_00002713
Biotype: transcript isomorph
Gene id: XLOC_001583
Gene Name: XLOC_001583
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2680-2693
0.040
1
8mer
544-568
0.031
2
7mer
2728-2750
0.016
1
6mer
1293-1315
0.002
1
LINC01088
hsa-miR-548h-5p
0.991

Gene Details
Chromosome: 4
Transcript: ENST00000505149
Biotype: antisense
Gene id: ENSG00000249307
Gene Name: LINC01088
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
376-396
0.049
12
8mer
570-581
0.023
4
6mer
430-448
0.015
12
RP11-734K23.9
hsa-miR-548h-5p
0.990

Gene Details
Chromosome: 2
Transcript: ENST00000613749
Biotype: lincRNA
Gene id: ENSG00000277701
Gene Name: RP11-734K23.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-548h-5p
Sequence: aaaaguaaucgcgguuuuuguc
MirBase ID: MIMAT0005928
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2750-2763
0.040
1
8mer
614-638
0.028
2
7mer
2798-2820
0.017
1
6mer
1363-1385
0.002
1
Funded by: