Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-641
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
37790-37809
0.016
2
7mer
127070-127088
0.016
13
8mer
24427-24446
0.010
1
8mer
8025-8048
0.010
2
7mer
183183-183209
0.010
5
8mer
157312-157325
0.008
3
8mer
49335-49354
0.008
5
8mer
244484-244503
0.007
Not Conserved
7mer
151093-151118
0.007
1
9mer
31731-31755
0.007
Not Conserved
8mer
19974-19998
0.006
2
9mer
78324-78345
0.006
2
6mer
267121-267140
0.006
2
8mer
212337-212358
0.005
1
7mer
28050-28070
0.005
5
7mer
108456-108476
0.005
1
7mer
42709-42725
0.005
2
7mer
89117-89131
0.005
2
7mer
164027-164044
0.005
4
7mer
258963-258977
0.004
1
7mer
106766-106783
0.004
2
7mer
28243-28270
0.004
1
8mer
204334-204360
0.004
2
7mer
153229-153255
0.004
1
7mer
135848-135869
0.004
1
6mer
377-399
0.004
4
7mer
2670-2690
0.004
1
7mer
126212-126221
0.004
4
8mer
75311-75331
0.004
2
7mer
215986-216013
0.004
5
8mer
122137-122157
0.004
1
8mer
9864-9881
0.004
3
7mer
17201-17216
0.003
2
7mer
76318-76344
0.003
1
7mer
12520-12541
0.003
2
7mer
29132-29148
0.003
1
7mer
83277-83300
0.003
2
7mer
132663-132690
0.003
7
7mer
176933-176956
0.003
2
7mer
138187-138204
0.003
1
7mer
131702-131718
0.003
5
7mer
265639-265665
0.003
1
7mer
26957-26981
0.003
3
7mer
49591-49616
0.003
2
7mer
5331-5350
0.003
6
6mer
687-711
0.003
2
6mer
50553-50568
0.003
5
7mer
153918-153937
0.003
Not Conserved
7mer
207101-207127
0.003
2
7mer
210774-210790
0.003
3
7mer
222911-222931
0.003
2
7mer
106224-106240
0.003
1
6mer
155316-155332
0.003
2
6mer
147735-147755
0.003
3
7mer
140594-140618
0.003
3
7mer
147517-147541
0.003
1
7mer
177502-177517
0.003
1
7mer
210050-210069
0.002
1
7mer
132779-132805
0.002
2
6mer
182698-182707
0.002
6
7mer
138506-138521
0.002
1
6mer
166684-166707
0.002
6
6mer
121387-121403
0.002
1
6mer
8902-8918
0.002
1
6mer
221793-221809
0.002
1
7mer
254107-254127
0.002
2
7mer
73694-73706
0.002
1
6mer
137868-137886
0.002
2
6mer
21080-21103
0.002
3
6mer
101930-101950
0.002
3
6mer
244934-244960
0.002
1
6mer
257976-257992
0.002
2
7mer
237550-237572
0.002
2
7mer
207970-207990
0.002
1
6mer
66631-66652
0.002
3
6mer
72785-72804
0.002
2
6mer
110880-110894
0.002
1
6mer
89565-89574
0.002
2
7mer
72463-72480
0.002
2
6mer
144893-144917
0.002
1
6mer
1356-1372
0.002
2
6mer
139724-139735
0.002
2
6mer
198207-198229
0.002
2
6mer
150203-150229
0.002
3
6mer
228369-228389
0.002
1
7mer
37973-37994
0.002
2
6mer
37323-37348
0.002
3
6mer
38574-38596
0.002
2
6mer
107374-107385
0.002
5
6mer
65520-65546
0.002
2
7mer
195956-195971
0.002
4
7mer
210845-210868
0.002
2
6mer
61608-61627
0.002
5
6mer
63306-63316
0.002
5
6mer
78929-78954
0.002
5
6mer
129766-129774
0.002
2
6mer
2318-2336
0.002
2
7mer
244994-245013
0.002
1
6mer
203722-203746
0.002
3
6mer
19680-19691
0.002
2
6mer
216248-216271
0.002
2
6mer
44757-44783
0.002
1
6mer
48554-48569
0.002
2
6mer
108923-108949
0.002
1
6mer
9300-9325
0.002
2
6mer
136739-136765
0.002
1
6mer
251939-251963
0.002
1
6mer
20247-20260
0.002
1
6mer
140027-140051
0.002
2
6mer
5951-5978
0.002
5
6mer
95188-95213
0.002
2
6mer
167441-167465
0.001
2
6mer
181690-181707
0.001
4
6mer
117040-117059
0.001
1
6mer
151231-151245
0.001
2
6mer
58248-58271
0.001
4
6mer
76611-76617
0.001
1
6mer
150338-150354
0.001
5
6mer
93554-93572
0.001
1
6mer
53314-53331
0.001
2
6mer
201069-201095
0.001
1
6mer
80106-80129
0.001
1
6mer
188204-188218
0.001
2
6mer
190822-190837
0.001
1
6mer
28598-28608
0.001
Not Conserved
6mer
164295-164316
0.001
2
6mer
103908-103928
0.001
1
6mer
204819-204839
0.001
2
6mer
128274-128292
0.001
1
6mer
23936-23954
0.001
2
6mer
156959-156980
0.001
2
6mer
42059-42076
0.001
2
6mer
24083-24107
0.001
3
8mer+mismatch
196299-196319
0.001
1
6mer
182100-182119
0.001
2
6mer
112466-112483
0.001
1
6mer
2498-2515
0.001
4
6mer
186862-186872
0.001
2
6mer
148798-148824
0.001
1
7mer
207159-207182
0.001
2
6mer
120794-120807
0.001
Not Conserved
6mer
223031-223049
0.001
2
6mer
140350-140377
0.001
2
6mer
55022-55038
0.001
1
6mer
135952-135977
0.001
3
6mer
221985-222010
0.001
3
6mer
9786-9803
0.001
2
6mer
241239-241261
0.001
2
6mer
251678-251700
0.001
1
6mer
246208-246230
0.001
1
7mer
53355-53374
0.001
Not Conserved
7mer
265658-265673
0.001
2
6mer
215335-215348
0.001
Not Conserved
6mer
156792-156813
0.001
Not Conserved
6mer
132714-132736
0.001
1
6mer
89597-89618
0.001
2
6mer
9367-9382
0.000
1
6mer
120794-120814
0.000
2
AC006548.28
hsa-miR-641
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
67826-67847
0.013
1
9mer
1373-1387
0.012
2
9mer
35753-35775
0.010
1
7mer
66228-66253
0.008
Not Conserved
7mer
30290-30308
0.006
2
7mer
79405-79421
0.005
Not Conserved
7mer
76231-76258
0.005
1
7mer
63755-63778
0.005
1
7mer
41075-41101
0.004
3
7mer
66010-66033
0.004
1
7mer
53554-53574
0.004
Not Conserved
7mer
34084-34100
0.004
2
7mer
44647-44666
0.003
2
8mer
1652-1677
0.003
1
7mer
27906-27926
0.003
2
7mer
27127-27154
0.003
2
7mer
71777-71795
0.003
1
7mer
28632-28657
0.003
2
7mer
27204-27221
0.003
2
7mer
58547-58572
0.003
2
7mer
67363-67389
0.003
1
6mer
23538-23564
0.003
3
7mer
16134-16144
0.002
1
7mer
77001-77021
0.002
1
7mer
52789-52816
0.002
Not Conserved
7mer
68325-68348
0.002
1
7mer
56946-56963
0.002
2
6mer
28076-28101
0.002
2
7mer
52864-52885
0.002
Not Conserved
6mer
31373-31396
0.002
2
6mer
26177-26191
0.002
1
6mer
8299-8323
0.002
2
6mer
83752-83774
0.002
2
6mer
76634-76659
0.002
Not Conserved
6mer
80719-80742
0.002
2
6mer
44171-44197
0.002
5
6mer
62155-62169
0.002
1
6mer
16938-16963
0.002
2
7mer
56351-56371
0.002
2
6mer
66506-66519
0.002
1
6mer
53188-53213
0.002
Not Conserved
7mer
79725-79741
0.002
1
6mer
55879-55902
0.002
2
6mer
55558-55575
0.002
2
6mer
32067-32092
0.002
2
6mer
9180-9195
0.002
3
6mer
2238-2256
0.002
2
6mer
83095-83111
0.002
1
6mer
7232-7252
0.002
2
6mer
18759-18781
0.002
2
6mer
72934-72948
0.002
2
6mer
74103-74116
0.001
1
6mer
34880-34897
0.001
2
6mer
70430-70448
0.001
1
7mer
30502-30522
0.001
1
7mer
30608-30622
0.001
2
6mer
46159-46172
0.001
Not Conserved
6mer
30655-30682
0.001
2
7mer
56457-56471
0.001
2
6mer
38151-38174
0.001
1
6mer
2088-2108
0.001
2
6mer
8579-8598
0.001
1
6mer
78131-78146
0.001
1
6mer
81809-81830
0.001
2
6mer
29621-29644
0.001
1
6mer
30018-30039
0.001
1
6mer
56504-56529
0.001
2
6mer
79772-79789
0.001
1
6mer
54857-54872
0.001
2
6mer
38381-38391
0.001
3
6mer
39531-39552
0.001
1
6mer
57961-57979
0.001
1
6mer
77966-77985
0.001
1
6mer
29038-29053
0.001
2
6mer
70338-70360
0.001
1
6mer
46408-46423
0.001
Not Conserved
6mer
39377-39400
0.001
2
6mer
23818-23837
0.001
2
6mer
55458-55480
0.001
1
6mer
46111-46126
0.001
Not Conserved
6mer
46335-46345
0.000
Not Conserved
6mer
53069-53083
0.000
Not Conserved
DPP10-AS2
hsa-miR-641
1.000

Gene Details
Chromosome: 2
Transcript: ENST00000446992
Biotype: antisense
Gene id: ENSG00000235717
Gene Name: DPP10-AS2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
457-474
0.059
2
8mer
399-416
0.049
Not Conserved
8mer
341-358
0.035
Not Conserved
8mer
486-499
0.029
1
RP11-74K11.2
hsa-miR-641
1.000

Gene Details
Chromosome: 12
Transcript: ENST00000551029
Biotype: antisense
Gene id: ENSG00000258035
Gene Name: RP11-74K11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-46
0.092
8
9mer
41-56
0.064
9
RP11-74K11.2
hsa-miR-641
1.000

Gene Details
Chromosome: 12
Transcript: ENST00000550759
Biotype: antisense
Gene id: ENSG00000258035
Gene Name: RP11-74K11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25-43
0.090
8
9mer
38-53
0.060
9
RP13-216E22.4
hsa-miR-641
1.000

Gene Details
Chromosome: X
Transcript: ENST00000444482
Biotype: lincRNA
Gene id: ENSG00000228906
Gene Name: RP13-216E22.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
277-291
0.069
2
8mer
207-224
0.067
2
XLOC_001489
hsa-miR-641
1.000

Gene Details
Chromosome: chr2
Transcript: TCONS_00002901
Biotype: transcript isomorph
Gene id: XLOC_001489
Gene Name: XLOC_001489
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2758-2777
0.037
2
8mer
367-383
0.032
1
7mer
334-357
0.020
1
7mer
583-608
0.014
1
7mer
229-253
0.010
1
7mer
826-837
0.009
1
6mer
2195-2218
0.005
1
6mer
1383-1396
0.004
1
6mer
1045-1061
0.004
1
XLOC_013863
hsa-miR-641
0.998

Gene Details
Chromosome: chr21
Transcript: TCONS_00029195
Biotype: transcript isomorph
Gene id: XLOC_013863
Gene Name: XLOC_013863
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
17-36
0.041
2
9mer
292-306
0.018
1
9mer
3402-3426
0.015
2
7mer
3674-3701
0.015
2
7mer
460-480
0.012
3
7mer
2164-2184
0.004
3
7mer
681-706
0.004
1
6mer
121-143
0.004
1
6mer
2298-2318
0.001
2
XLOC_009222
hsa-miR-641
0.998

Gene Details
Chromosome: chr11
Transcript: TCONS_00019399
Biotype: transcript isomorph
Gene id: XLOC_009222
Gene Name: XLOC_009222
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5763-5786
0.056
1
7mer
275-287
0.024
1
6mer
5529-5533
0.011
1
7mer
2294-2306
0.009
1
6mer
3802-3828
0.005
1
6mer
3677-3689
0.005
1
6mer
5106-5131
0.002
Not Conserved
ZNRD1-AS1
hsa-miR-641
0.997

Gene Details
Chromosome: 6
Transcript: ENST00000444051
Biotype: antisense
Gene id: ENSG00000204623
Gene Name: ZNRD1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
226-245
0.050
2
8mer
5764-5781
0.018
2
8mer
3272-3293
0.016
1
6mer
164-173
0.010
2
6mer
9677-9700
0.006
1
7mer
2758-2777
0.005
1
6mer
6058-6071
0.004
2
AC114765.2
hsa-miR-641
0.996

Gene Details
Chromosome: 2
Transcript: ENST00000438633
Biotype: lincRNA
Gene id: ENSG00000235337
Gene Name: AC114765.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
320-345
0.101
10
RP11-809F4.3
hsa-miR-641
0.996

Gene Details
Chromosome: 3
Transcript: ENST00000562617
Biotype: lincRNA
Gene id: ENSG00000260217
Gene Name: RP11-809F4.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
524-539
0.052
2
8mer
835-857
0.018
1
7mer
13-30
0.016
1
6mer
1741-1758
0.014
2
CRNDE
hsa-miR-641
0.996

Gene Details
Chromosome: 16
Transcript: ENST00000560029
Biotype: lincRNA
Gene id: ENSG00000245694
Gene Name: CRNDE
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
43-68
0.101
6
CRNDE
hsa-miR-641
0.996

Gene Details
Chromosome: 16
Transcript: ENST00000502066
Biotype: lincRNA
Gene id: ENSG00000245694
Gene Name: CRNDE
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
43-68
0.100
6
CRNDE
hsa-miR-641
0.996

Gene Details
Chromosome: 16
Transcript: ENST00000559598
Biotype: lincRNA
Gene id: ENSG00000245694
Gene Name: CRNDE
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
49-74
0.100
6
RP11-687D19.1
hsa-miR-641
0.995

Gene Details
Chromosome: 18
Transcript: ENST00000597142
Biotype: lincRNA
Gene id: ENSG00000268566
Gene Name: RP11-687D19.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
8-29
0.098
11
XLOC_008295
hsa-miR-641
0.995

Gene Details
Chromosome: chrY
Transcript: TCONS_00017578
Biotype: transcript isomorph
Gene id: XLOC_008295
Gene Name: XLOC_008295
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
5032-5057
0.021
1
6mer
150-176
0.019
1
6mer
4860-4864
0.016
1
7mer
3711-3728
0.014
1
7mer
2153-2174
0.011
1
7mer
2635-2658
0.010
1
6mer
3359-3385
0.007
1
RP11-96K19.4
hsa-miR-641
0.995

Gene Details
Chromosome: 1
Transcript: ENST00000562952
Biotype: sense_overlapping
Gene id: ENSG00000261654
Gene Name: RP11-96K19.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
488-506
0.020
2
6mer
596-619
0.014
2
8mer
3829-3842
0.013
1
6mer
297-312
0.012
2
7mer
4365-4388
0.011
2
7mer
3949-3966
0.011
2
7mer
1876-1891
0.006
1
8mer
3368-3390
0.005
Not Conserved
6mer
2444-2454
0.003
1
6mer
2630-2649
0.002
Not Conserved
TTTY15
hsa-miR-641
0.995

Gene Details
Chromosome: Y
Transcript: ENST00000440408
Biotype: lincRNA
Gene id: ENSG00000233864
Gene Name: TTTY15
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
5032-5057
0.020
1
6mer
150-176
0.019
1
6mer
4860-4864
0.016
1
7mer
3711-3728
0.014
1
7mer
2153-2174
0.011
1
7mer
2635-2658
0.010
1
6mer
3359-3385
0.007
1
RP11-142O6.1
hsa-miR-641
0.994

Gene Details
Chromosome: 17
Transcript: ENST00000584382
Biotype: sense_intronic
Gene id: ENSG00000266371
Gene Name: RP11-142O6.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
45-68
0.028
2
7mer
77-103
0.025
1
8mer
2013-2039
0.023
1
7mer
458-478
0.017
1
Funded by: