Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-642b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-642b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
267134-267148
0.011
1
8mer
15178-15184
0.011
2
8mer
230817-230835
0.010
1
8mer
16230-16251
0.009
1
7mer
151096-151116
0.007
1
7mer
258186-258208
0.006
2
9mer
68617-68639
0.006
3
7mer
36382-36403
0.005
1
7mer
125758-125780
0.005
2
8mer
112328-112344
0.005
4
8mer
203402-203429
0.005
1
7mer
172792-172807
0.005
3
8mer
214172-214190
0.004
2
7mer
87692-87709
0.004
2
7mer
32399-32414
0.004
2
7mer
170659-170680
0.004
2
7mer
221442-221462
0.004
1
7mer
237550-237570
0.003
2
7mer
77973-77989
0.003
2
6mer
91195-91206
0.003
3
7mer
74397-74423
0.003
4
8mer
148596-148603
0.003
3
7mer
29246-29272
0.003
3
7mer
114546-114564
0.003
3
7mer
203761-203778
0.003
2
7mer
82487-82508
0.003
2
7mer
186924-186949
0.003
2
7mer
12521-12539
0.003
2
7mer
36060-36074
0.003
1
7mer
265625-265643
0.003
2
7mer
108944-108956
0.002
1
7mer
254100-254121
0.002
2
7mer
78739-78766
0.002
2
7mer
105820-105830
0.002
2
6mer
71617-71637
0.002
2
7mer
196290-196305
0.002
2
6mer
182682-182706
0.002
7
6mer
118661-118686
0.002
2
7mer
48077-48092
0.002
4
7mer
211033-211051
0.002
Not Conserved
6mer
174745-174754
0.002
1
7mer
78266-78278
0.002
2
7mer
58620-58646
0.002
3
6mer
210368-210388
0.002
5
6mer
129045-129058
0.002
7
6mer
200896-200914
0.002
1
6mer
28245-28268
0.002
1
7mer
260914-260936
0.002
2
6mer
89153-89167
0.002
1
6mer
72455-72478
0.002
3
6mer
120833-120844
0.002
1
7mer
55475-55499
0.002
1
6mer
83891-83909
0.002
2
6mer
101289-101315
0.002
4
6mer
9487-9505
0.002
7
7mer
101693-101717
0.002
1
6mer
227648-227666
0.002
2
7mer
104004-104019
0.002
3
7mer
154067-154083
0.002
1
6mer
156402-156423
0.002
4
6mer
140093-140105
0.002
1
6mer
232822-232836
0.002
2
6mer
168262-168277
0.002
4
7mer
22633-22644
0.002
2
6mer
163822-163841
0.002
6
6mer
80816-80836
0.002
2
6mer
225144-225168
0.002
1
6mer
79716-79735
0.002
1
6mer
167566-167582
0.002
2
6mer
48429-48438
0.002
1
6mer
63294-63315
0.002
5
7mer
95102-95125
0.002
2
6mer
37698-37723
0.002
1
7mer
161487-161507
0.001
2
7mer
196290-196313
0.001
1
6mer
150203-150228
0.001
2
6mer
37919-37934
0.001
2
6mer
109424-109445
0.001
3
6mer
86599-86611
0.001
2
6mer
109815-109829
0.001
1
6mer
167056-167075
0.001
4
6mer
53535-53549
0.001
3
6mer
214406-214432
0.001
2
6mer
51252-51275
0.001
1
6mer
175473-175489
0.001
2
6mer
195941-195960
0.001
1
6mer
27103-27122
0.001
2
6mer
140334-140358
0.001
3
6mer
212441-212460
0.001
2
7mer
205446-205466
0.001
3
6mer
148537-148562
0.001
1
7mer
203424-203439
0.001
1
6mer
222912-222929
0.001
2
6mer
97415-97438
0.001
1
6mer
243560-243586
0.001
1
6mer
187798-187824
0.001
3
6mer
7383-7400
0.001
2
6mer
265124-265137
0.001
2
6mer
172292-172313
0.001
2
6mer
111556-111574
0.001
2
6mer
216669-216687
0.001
1
6mer
61291-61309
0.001
Not Conserved
6mer
153918-153935
0.001
Not Conserved
6mer
163907-163932
0.001
4
6mer
103909-103927
0.001
1
6mer
51013-51034
0.001
1
6mer
233037-233054
0.001
2
6mer
34433-34456
0.001
2
6mer
217822-217843
0.001
3
6mer
116428-116446
0.001
1
6mer
37150-37172
0.001
2
6mer
208178-208192
0.001
2
6mer
265880-265896
0.001
2
6mer
215323-215346
0.001
Not Conserved
7mer
196311-196329
0.001
2
7mer
211077-211099
0.001
2
7mer
211063-211079
0.001
Not Conserved
6mer
118144-118169
0.001
1
6mer
96504-96529
0.001
1
6mer
262405-262427
0.001
1
6mer
6190-6214
0.001
2
6mer
79901-79915
0.001
1
6mer
58185-58199
0.001
1
6mer
258231-258246
0.001
3
6mer
111572-111596
0.001
7
7mer
211071-211085
0.001
Not Conserved
6mer
32420-32442
0.001
1
6mer
262515-262538
0.000
3
6mer
48179-48200
0.000
1
AC006548.28
hsa-miR-642b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
67260-67284
0.020
1
7mer
253-271
0.012
1
8mer
82636-82662
0.009
2
8mer
26621-26648
0.008
2
8mer
76310-76336
0.008
1
7mer
28634-28651
0.006
2
8mer
27129-27149
0.006
1
7mer
52866-52892
0.006
Not Conserved
7mer
31533-31551
0.005
1
7mer
28238-28263
0.005
2
8mer
79727-79740
0.005
1
7mer
27206-27232
0.005
2
7mer
67088-67111
0.005
1
7mer
59829-59841
0.004
1
7mer
43953-43980
0.004
2
6mer
218-238
0.004
2
7mer
15497-15516
0.004
1
7mer
77215-77236
0.004
1
7mer
77461-77472
0.003
1
7mer
908-922
0.003
Not Conserved
7mer
28120-28133
0.003
2
7mer
28368-28394
0.003
1
7mer
52791-52811
0.003
Not Conserved
7mer
75727-75749
0.003
Not Conserved
7mer
8251-8276
0.003
2
7mer
77003-77029
0.003
1
7mer
53880-53903
0.003
Not Conserved
7mer
76233-76253
0.003
1
7mer
54009-54035
0.003
Not Conserved
7mer
70479-70491
0.002
1
6mer
16157-16177
0.002
6
7mer
53762-53776
0.002
Not Conserved
7mer
77727-77745
0.002
1
7mer
27908-27934
0.002
2
6mer
16526-16549
0.002
2
7mer
54280-54294
0.002
Not Conserved
6mer
55269-55288
0.002
2
7mer
53556-53582
0.002
Not Conserved
6mer
41077-41102
0.002
3
6mer
29436-29460
0.002
1
6mer
33516-33534
0.002
1
6mer
42655-42679
0.002
1
7mer
61989-62007
0.002
1
6mer
15084-15105
0.001
5
6mer
9293-9309
0.001
1
6mer
13785-13801
0.001
2
7mer
53856-53872
0.001
Not Conserved
6mer
24331-24355
0.001
2
6mer
10510-10528
0.001
3
7mer
62884-62907
0.001
1
6mer
22076-22094
0.001
2
6mer
46409-46430
0.001
Not Conserved
6mer
27933-27959
0.001
2
7mer
6752-6770
0.001
1
6mer
25656-25678
0.001
2
6mer
18537-18558
0.001
1
6mer
37965-37987
0.001
2
6mer
63203-63218
0.001
2
6mer
14383-14410
0.001
2
6mer
80021-80043
0.001
1
6mer
53581-53607
0.001
Not Conserved
6mer
15826-15849
0.001
2
6mer
65393-65415
0.001
1
6mer
14097-14111
0.001
2
6mer
30885-30897
0.001
1
6mer
74753-74770
0.001
1
6mer
60829-60852
0.001
1
6mer
39874-39896
0.001
2
6mer
21255-21264
0.001
Not Conserved
6mer
8246-8266
0.001
3
6mer
59693-59714
0.000
1
6mer
80002-80015
0.000
1
6mer
37918-37938
0.000
2
RP11-982M15.8
hsa-miR-642b-3p
1.000

Gene Details
Chromosome: 14
Transcript: ENST00000564585
Biotype: lincRNA
Gene id: ENSG00000260792
Gene Name: RP11-982M15.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3693-3711
0.014
2
7mer
3713-3732
0.012
2
7mer
3567-3589
0.012
2
7mer
3594-3612
0.010
1
7mer
3638-3665
0.009
1
7mer
3479-3497
0.009
1
7mer
3730-3756
0.008
1
7mer
3663-3683
0.008
1
7mer
3606-3624
0.008
1
7mer
3614-3632
0.008
1
7mer
3551-3569
0.007
Not Conserved
7mer
3417-3431
0.007
1
7mer
3587-3602
0.007
1
7mer
3399-3415
0.006
1
7mer
3509-3526
0.006
Not Conserved
7mer
3461-3483
0.006
Not Conserved
7mer
3622-3640
0.006
Not Conserved
7mer
3331-3345
0.006
1
7mer
3630-3646
0.006
Not Conserved
7mer
3275-3291
0.005
1
7mer
3301-3319
0.005
1
6mer
693-720
0.004
2
7mer
3385-3403
0.004
Not Conserved
7mer
3313-3333
0.004
Not Conserved
7mer
3251-3269
0.003
1
6mer
3262-3279
0.003
2
7mer
973-993
0.002
1
RP11-96K19.4
hsa-miR-642b-3p
1.000

Gene Details
Chromosome: 1
Transcript: ENST00000562952
Biotype: sense_overlapping
Gene id: ENSG00000261654
Gene Name: RP11-96K19.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
490-516
0.094
2
8mer
1612-1638
0.022
2
8mer
1878-1905
0.021
2
7mer
2057-2082
0.020
2
7mer
4357-4373
0.008
2
7mer
1475-1498
0.005
1
7mer
2989-3004
0.001
Not Conserved
AC002519.8
hsa-miR-642b-3p
1.000

Gene Details
Chromosome: 16
Transcript: ENST00000570073
Biotype: sense_intronic
Gene id: ENSG00000259810
Gene Name: AC002519.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2683-2697
0.060
2
8mer
354-378
0.055
1
6mer
2674-2687
0.018
2
7mer
1466-1480
0.009
1
LINC00662
hsa-miR-642b-3p
0.998

Gene Details
Chromosome: 19
Transcript: ENST00000590523
Biotype: lincRNA
Gene id: ENSG00000261824
Gene Name: LINC00662
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1104-1118
0.089
1
7mer
1701-1719
0.020
1
7mer
828-850
0.006
Not Conserved
LINC00662
hsa-miR-642b-3p
0.998

Gene Details
Chromosome: 19
Transcript: NR_027301.1
Biotype: lincRNA
Gene id: NR_027301.1 (gene)
Gene Name: LINC00662
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1102-1116
0.088
1
7mer
1699-1717
0.020
1
7mer
826-848
0.006
Not Conserved
XLOC_012598
hsa-miR-642b-3p
0.997

Gene Details
Chromosome: chr18
Transcript: TCONS_00026224
Biotype: transcript isomorph
Gene id: XLOC_012598
Gene Name: XLOC_012598
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2033-2045
0.101
1
7mer
1314-1326
0.008
Not Conserved
LINC01224
hsa-miR-642b-3p
0.995

Gene Details
Chromosome: 19
Transcript: ENST00000596283
Biotype: lincRNA
Gene id: ENSG00000269416
Gene Name: LINC01224
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
347-373
0.053
2
8mer
185-207
0.044
1
XLOC_005208
hsa-miR-642b-3p
0.995

Gene Details
Chromosome: chr6
Transcript: TCONS_00011743
Biotype: transcript isomorph
Gene id: XLOC_005208
Gene Name: XLOC_005208
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4399-4416
0.081
4
6mer
394-411
0.004
2
7mer
2721-2747
0.003
1
7mer
1876-1893
0.003
1
6mer
3152-3164
0.002
1
6mer
1998-2018
0.001
1
6mer
1604-1620
0.001
1
FAM224A
hsa-miR-642b-3p
0.992

Gene Details
Chromosome: Y
Transcript: ENST00000419557
Biotype: lincRNA
Gene id: ENSG00000233522
Gene Name: FAM224A
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1534-1547
0.088
1
6mer
630-643
0.002
Not Conserved
XLOC_003651
hsa-miR-642b-3p
0.992

Gene Details
Chromosome: chr4
Transcript: TCONS_00007401
Biotype: transcript isomorph
Gene id: XLOC_003651
Gene Name: XLOC_003651
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
Fibroblasts Lung Normal/Primary


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1912-1927
0.089
2
RP11-809F4.3
hsa-miR-642b-3p
0.991

Gene Details
Chromosome: 3
Transcript: ENST00000562617
Biotype: lincRNA
Gene id: ENSG00000260217
Gene Name: RP11-809F4.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
958-981
0.088
2
RP11-147L13.14
hsa-miR-642b-3p
0.991

Gene Details
Chromosome: 17
Transcript: ENST00000612725
Biotype: lincRNA
Gene id: ENSG00000278740
Gene Name: RP11-147L13.14
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
236-250
0.088
1
RP3-323A16.1
hsa-miR-642b-3p
0.991

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
37183-37204
0.030
11
8mer
2574-2582
0.010
2
8mer
47770-47789
0.010
1
7mer
19998-20019
0.005
2
7mer
22321-22339
0.005
3
7mer
4500-4520
0.003
2
6mer
53526-53546
0.002
2
6mer
2349-2366
0.002
2
6mer
9487-9500
0.002
2
6mer
29908-29922
0.002
1
6mer
35162-35188
0.002
2
6mer
49140-49153
0.001
2
6mer
38479-38498
0.001
2
6mer
52777-52791
0.001
2
6mer
42727-42743
0.001
2
6mer
51063-51088
0.001
2
6mer
17957-17973
0.001
2
6mer
4043-4058
0.001
2
6mer
31411-31427
0.001
1
6mer
41049-41074
0.001
1
6mer
30177-30191
0.001
2
6mer
5585-5601
0.001
1
6mer
29600-29612
0.001
1
6mer
39729-39741
0.001
1
6mer
50247-50266
0.001
2
XLOC_009000
hsa-miR-642b-3p
0.989

Gene Details
Chromosome: chr10
Transcript: TCONS_00018649
Biotype: transcript isomorph
Gene id: XLOC_009000
Gene Name: XLOC_009000
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1020-1039
0.006
1
6mer
38-57
0.006
1
6mer
174-193
0.005
1
6mer
142-157
0.005
1
6mer
954-969
0.005
1
6mer
886-905
0.005
1
6mer
754-769
0.004
1
6mer
350-365
0.004
1
6mer
110-125
0.004
Not Conserved
6mer
690-705
0.004
1
6mer
654-673
0.003
1
6mer
382-397
0.003
1
6mer
446-465
0.003
1
6mer
618-637
0.003
1
6mer
482-501
0.003
1
6mer
414-429
0.003
1
6mer
722-737
0.003
1
6mer
820-835
0.003
Not Conserved
6mer
278-297
0.003
1
6mer
314-333
0.002
1
6mer
586-601
0.002
Not Conserved
6mer
518-533
0.002
Not Conserved
6mer
550-569
0.002
1
RP11-732A19.2
hsa-miR-642b-3p
0.988

Gene Details
Chromosome: 11
Transcript: ENST00000527398
Biotype: sense_overlapping
Gene id: ENSG00000254641
Gene Name: RP11-732A19.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
155-174
0.083
10
LINC01206
hsa-miR-642b-3p
0.987

Gene Details
Chromosome: 3
Transcript: ENST00000482787
Biotype: lincRNA
Gene id: ENSG00000242512
Gene Name: LINC01206
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
9290-9312
0.040
1
8mer
7859-7884
0.015
1
8mer
8060-8079
0.013
4
7mer
6976-7002
0.006
2
7mer
4464-4489
0.004
2
7mer
5650-5667
0.004
1
RP11-335E6.4
hsa-miR-642b-3p
0.987

Gene Details
Chromosome: 1
Transcript: ENST00000447183
Biotype: lincRNA
Gene id: ENSG00000271593
Gene Name: RP11-335E6.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
59-83
0.081
7
LINC01224
hsa-miR-642b-3p
0.986

Gene Details
Chromosome: 19
Transcript: ENST00000600643
Biotype: lincRNA
Gene id: ENSG00000269416
Gene Name: LINC01224
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
584-610
0.045
2
8mer
422-444
0.036
1
Funded by: