Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-93-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-93-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
175915-175927
0.013
4
9mer
14011-14035
0.013
1
8mer
220519-220543
0.009
2
8mer
165228-165239
0.009
5
9mer
10725-10745
0.009
1
8mer
89496-89518
0.008
4
8mer
107253-107269
0.008
2
9mer
225492-225516
0.008
2
7mer
50478-50500
0.006
1
8mer
81577-81599
0.006
7
7mer
193799-193819
0.006
1
7mer
198075-198094
0.006
1
7mer
131802-131819
0.006
8
8mer
104450-104470
0.005
3
7mer
250851-250868
0.005
1
7mer
145004-145029
0.005
8
7mer
203679-203700
0.005
1
7mer
172347-172358
0.005
3
9mer
199223-199247
0.005
2
9mer
52131-52155
0.005
2
7mer
52894-52909
0.004
5
7mer
56232-56249
0.004
2
7mer
160691-160714
0.004
4
9mer
155511-155532
0.004
2
9mer
67833-67857
0.004
2
7mer
251110-251132
0.004
1
8mer
261772-261791
0.004
1
9mer
180846-180864
0.004
2
7mer
18591-18611
0.004
2
9mer
221547-221567
0.004
2
7mer
178035-178055
0.004
2
9mer
234646-234670
0.004
2
8mer
256647-256666
0.004
1
6mer
59220-59238
0.004
10
9mer
213966-213982
0.004
3
9mer
250219-250246
0.004
1
9mer
244863-244887
0.004
1
9mer
177421-177441
0.003
2
7mer
244007-244026
0.003
2
9mer
11449-11473
0.003
2
9mer
27724-27745
0.003
1
6mer
114582-114597
0.003
9
8mer
121444-121464
0.003
2
7mer
113931-113955
0.003
2
7mer
187401-187413
0.003
4
7mer
136113-136131
0.003
2
9mer
236472-236496
0.003
2
9mer
135107-135131
0.003
2
6mer
267034-267054
0.003
1
6mer
13076-13096
0.003
10
7mer
61676-61700
0.003
2
9mer
109484-109504
0.003
2
9mer
38248-38267
0.003
2
9mer
239060-239080
0.003
2
9mer
262098-262117
0.003
2
7mer
68855-68875
0.003
1
9mer
102888-102907
0.003
2
9mer
249438-249458
0.003
1
9mer
188881-188905
0.003
2
9mer
64967-64991
0.003
2
9mer
225068-225092
0.003
2
9mer
253387-253411
0.003
2
9mer
237872-237892
0.003
2
9mer
122233-122252
0.003
2
9mer
251548-251572
0.003
1
9mer
223518-223538
0.003
2
9mer
77174-77194
0.003
2
7mer
194480-194494
0.003
2
9mer
84837-84855
0.003
3
9mer
192477-192497
0.003
1
6mer
917-933
0.003
2
7mer
101861-101879
0.003
2
9mer
187101-187125
0.003
1
6mer
92503-92524
0.003
4
9mer
114894-114918
0.003
2
7mer
154794-154815
0.003
3
9mer
60218-60242
0.003
2
9mer
252057-252081
0.003
2
9mer
14855-14875
0.003
1
6mer
1218-1242
0.003
5
9mer
231656-231673
0.003
1
6mer
150454-150475
0.003
6
9mer
263098-263122
0.002
1
9mer
167715-167739
0.002
2
6mer
127554-127569
0.002
3
9mer
213280-213300
0.002
1
9mer
73054-73074
0.002
1
9mer
174440-174464
0.002
1
6mer
227122-227137
0.002
3
7mer
115881-115906
0.002
2
9mer
8822-8842
0.002
1
6mer
17522-17546
0.002
2
6mer
131045-131064
0.002
2
6mer
169328-169340
0.002
1
6mer
2128-2132
0.002
1
6mer
43071-43091
0.002
2
6mer
52419-52433
0.002
5
6mer
79394-79407
0.002
2
9mer
206111-206131
0.002
1
9mer
37464-37484
0.002
Not Conserved
7mer
255688-255713
0.002
2
6mer
182715-182734
0.002
8
9mer
247889-247909
0.002
1
6mer
88206-88228
0.002
4
7mer
98431-98447
0.002
1
6mer
175138-175155
0.002
3
9mer
209139-209159
0.002
2
6mer
123024-123041
0.002
3
9mer
193330-193349
0.002
Not Conserved
6mer
116880-116887
0.002
2
6mer
13490-13513
0.002
2
6mer
16899-16921
0.002
2
6mer
219870-219891
0.002
6
9mer
67545-67569
0.002
2
6mer
73994-74018
0.002
3
6mer
78238-78251
0.002
4
6mer
84812-84832
0.002
4
6mer
71213-71234
0.002
2
7mer
255302-255322
0.002
2
6mer
151636-151658
0.002
4
7mer
45889-45904
0.002
2
6mer
161222-161242
0.002
2
7mer
228162-228174
0.002
2
6mer
131353-131375
0.002
3
7mer
240004-240028
0.002
2
9mer
181146-181170
0.002
Not Conserved
6mer
80779-80798
0.002
2
9mer
202786-202806
0.002
Not Conserved
6mer
260799-260814
0.002
2
6mer
45533-45559
0.002
2
9mer
14156-14180
0.002
2
6mer
184854-184867
0.002
2
6mer
216364-216386
0.002
6
6mer
166650-166672
0.002
3
7mer
242472-242491
0.002
1
6mer
130689-130714
0.002
2
7mer
240912-240936
0.002
2
7mer
85207-85227
0.002
2
7mer
73377-73397
0.002
1
6mer
51815-51832
0.002
4
9mer
231045-231065
0.002
1
6mer
185046-185070
0.002
2
6mer
92171-92189
0.002
3
6mer
227425-227451
0.002
5
6mer
205047-205065
0.002
3
6mer
44918-44936
0.002
1
6mer
157093-157118
0.002
4
6mer
140242-140268
0.002
1
7mer
166755-166774
0.002
2
6mer
127892-127912
0.002
1
6mer
77017-77041
0.002
3
7mer
177823-177843
0.002
2
6mer
145524-145538
0.002
1
6mer
202294-202318
0.002
Not Conserved
6mer
4883-4900
0.002
2
7mer
121086-121105
0.002
1
6mer
199899-199915
0.001
2
6mer
109797-109817
0.001
2
6mer
175535-175557
0.001
2
9mer
45037-45061
0.001
1
6mer
166387-166410
0.001
2
6mer
23495-23516
0.001
2
7mer
153365-153389
0.001
1
6mer
80075-80096
0.001
Not Conserved
6mer
173798-173824
0.001
2
9mer
250901-250921
0.001
1
7mer
35333-35354
0.001
2
6mer
126390-126416
0.001
2
6mer
196692-196717
0.001
2
6mer
30917-30934
0.001
2
6mer
182848-182871
0.001
4
6mer
1655-1677
0.001
2
6mer
57792-57814
0.001
2
6mer
153975-153999
0.001
2
7mer
134404-134430
0.001
2
6mer
245767-245785
0.001
1
6mer
67423-67449
0.001
4
6mer
236273-236299
0.001
1
9mer
234713-234732
0.001
1
6mer
103521-103544
0.001
1
6mer
5567-5585
0.001
2
6mer
51031-51047
0.001
2
6mer
183662-183686
0.001
1
6mer
144572-144588
0.001
3
6mer
14121-14140
0.001
1
6mer
237672-237696
0.001
Not Conserved
6mer
237251-237274
0.001
1
6mer
38921-38945
0.001
2
6mer
217106-217122
0.001
1
6mer
238168-238192
0.001
1
7mer
100419-100442
0.001
1
6mer
88216-88234
0.001
2
6mer
57822-57847
0.001
2
6mer
88243-88264
0.001
2
6mer
217221-217242
0.001
1
6mer
1674-1698
0.000
2
RP13-753N3.1
hsa-miR-93-5p
1.000

Gene Details
Chromosome: 17
Transcript: ENST00000584157
Biotype: antisense
Gene id: ENSG00000263531
Gene Name: RP13-753N3.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
5-24
0.063
1
9mer
515-539
0.053
1
9mer
141-161
0.046
1
TSIX
hsa-miR-93-5p
1.000

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
32816-32842
0.025
6
8mer
36146-36167
0.024
4
8mer
33130-33153
0.016
3
7mer
33542-33565
0.009
5
9mer
33-57
0.008
1
8mer
30749-30767
0.007
2
8mer
30777-30802
0.007
2
6mer
36429-36448
0.004
2
7mer
34024-34042
0.003
3
6mer
4833-4852
0.003
4
9mer
3393-3413
0.003
2
9mer
5222-5246
0.003
2
9mer
27462-27482
0.003
2
9mer
7150-7174
0.003
1
6mer
23868-23884
0.003
3
6mer
35704-35727
0.002
3
6mer
2347-2372
0.002
1
6mer
25804-25824
0.002
4
7mer
24335-24359
0.002
2
7mer
20024-20042
0.002
2
6mer
5845-5864
0.002
3
6mer
8986-9009
0.002
2
6mer
28099-28119
0.002
1
6mer
29031-29052
0.002
3
6mer
31396-31416
0.002
Not Conserved
6mer
20937-20955
0.001
1
6mer
19496-19508
0.001
2
6mer
34872-34887
0.001
2
6mer
27886-27906
0.001
2
6mer
10091-10105
0.001
Not Conserved
6mer
18210-18229
0.001
1
6mer
20458-20481
0.001
1
6mer
6015-6029
0.001
2
6mer
22858-22869
0.001
2
6mer
6111-6135
0.001
2
RP11-374M1.2
hsa-miR-93-5p
0.999

Gene Details
Chromosome: 9
Transcript: ENST00000612999
Biotype: retained_intron
Gene id: ENSG00000231527
Gene Name: RP11-374M1.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
159-173
0.077
2
9mer
1279-1299
0.045
1
RP11-13N13.5
hsa-miR-93-5p
0.999

Gene Details
Chromosome: 18
Transcript: ENST00000584148
Biotype: sense_intronic
Gene id: ENSG00000264188
Gene Name: RP11-13N13.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
308-332
0.072
1
9mer
146-170
0.049
1
XLOC_010384
hsa-miR-93-5p
0.999

Gene Details
Chromosome: chr13
Transcript: TCONS_00021786
Biotype: transcript isomorph
Gene id: XLOC_010384
Gene Name: XLOC_010384
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
513-533
0.062
2
8mer
606-625
0.043
6
6mer
14-31
0.007
5
6mer
1027-1048
0.005
4
KCNQ1OT1
hsa-miR-93-5p
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
38449-38469
0.014
1
7mer
18887-18904
0.009
2
9mer
422-446
0.007
2
7mer
34859-34877
0.007
1
9mer
12911-12931
0.005
2
7mer
88674-88700
0.004
3
8mer
71826-71845
0.004
1
8mer
18462-18480
0.004
2
7mer
55121-55142
0.004
5
7mer
82195-82217
0.003
1
7mer
15676-15697
0.003
2
6mer
1283-1299
0.003
2
7mer
78737-78749
0.003
1
9mer
12149-12173
0.003
1
7mer
71147-71166
0.002
1
6mer
3552-3568
0.002
2
6mer
14563-14584
0.002
2
6mer
87689-87705
0.002
2
6mer
84101-84121
0.002
2
6mer
4842-4853
0.002
3
6mer
66986-67009
0.002
2
6mer
70753-70773
0.002
1
6mer
10013-10036
0.002
1
7mer
77778-77804
0.002
2
6mer
49636-49653
0.002
2
6mer
7564-7589
0.002
2
6mer
47048-47071
0.002
4
7mer
52214-52238
0.002
2
6mer
46706-46727
0.002
2
6mer
68916-68927
0.002
2
6mer
18523-18539
0.002
2
6mer
38713-38728
0.001
1
6mer
33396-33412
0.001
1
6mer
30891-30911
0.001
1
6mer
14120-14145
0.001
1
6mer
1583-1601
0.001
1
6mer
52228-52254
0.001
2
6mer
87667-87688
0.000
2
XLOC_003276
hsa-miR-93-5p
0.998

Gene Details
Chromosome: chr3
Transcript: TCONS_00006679
Biotype: transcript isomorph
Gene id: XLOC_003276
Gene Name: XLOC_003276
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
43-64
0.089
8
7mer
11-29
0.026
8
RP11-374M1.2
hsa-miR-93-5p
0.998

Gene Details
Chromosome: 9
Transcript: ENST00000399894
Biotype: lincRNA
Gene id: ENSG00000231527
Gene Name: RP11-374M1.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
133-147
0.069
2
9mer
421-441
0.041
1
CTD-2015H6.3
hsa-miR-93-5p
0.996

Gene Details
Chromosome: 5
Transcript: ENST00000504300
Biotype: antisense
Gene id: ENSG00000249042
Gene Name: CTD-2015H6.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
51-73
0.090
3
9mer
418-438
0.012
2
COX10-AS1
hsa-miR-93-5p
0.996

Gene Details
Chromosome: 17
Transcript: ENST00000623598
Biotype: TEC
Gene id: ENSG00000236088
Gene Name: COX10-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1823-1849
0.101
1
RP11-553L6.5
hsa-miR-93-5p
0.996

Gene Details
Chromosome: 3
Transcript: ENST00000570269
Biotype: lincRNA
Gene id: ENSG00000259976
Gene Name: RP11-553L6.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
94-112
0.086
16
6mer
76-96
0.015
13
CTA-292E10.9
hsa-miR-93-5p
0.996

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
343-360
0.034
2
8mer
18583-18601
0.014
2
7mer
24406-24431
0.007
1
9mer
5246-5262
0.005
1
9mer
20048-20072
0.005
1
7mer
11425-11442
0.004
2
6mer
2670-2688
0.003
5
6mer
1120-1146
0.003
2
7mer
8934-8959
0.003
1
8mer
20709-20732
0.002
1
6mer
10077-10090
0.002
3
6mer
22091-22103
0.002
2
9mer
18912-18930
0.002
1
6mer
13829-13848
0.002
2
7mer
13155-13179
0.002
2
7mer
8987-9012
0.002
4
6mer
17559-17571
0.002
1
6mer
18659-18676
0.002
3
6mer
15303-15323
0.001
1
6mer
12391-12417
0.001
2
6mer
2777-2799
0.001
Not Conserved
RP11-554D14.7
hsa-miR-93-5p
0.995

Gene Details
Chromosome: 12
Transcript: ENST00000552154
Biotype: lincRNA
Gene id: ENSG00000257141
Gene Name: RP11-554D14.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
402-425
0.076
1
6mer
149-163
0.021
1
TTTY10
hsa-miR-93-5p
0.995

Gene Details
Chromosome: Y
Transcript: ENST00000455084
Biotype: lincRNA
Gene id: ENSG00000229236
Gene Name: TTTY10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
250-275
0.064
1
7mer
591-614
0.017
1
6mer
204-216
0.016
1
PVRL3-AS1
hsa-miR-93-5p
0.994

Gene Details
Chromosome: 3
Transcript: ENST00000467426
Biotype: antisense
Gene id: ENSG00000242242
Gene Name: PVRL3-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
603-623
0.094
7
AC002519.8
hsa-miR-93-5p
0.993

Gene Details
Chromosome: 16
Transcript: ENST00000570073
Biotype: sense_intronic
Gene id: ENSG00000259810
Gene Name: AC002519.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2057-2077
0.054
2
9mer
1133-1157
0.030
2
7mer
719-741
0.009
1
CTD-2313F11.1
hsa-miR-93-5p
0.992

Gene Details
Chromosome: 5
Transcript: ENST00000615566
Biotype: retained_intron
Gene id: ENSG00000240535
Gene Name: CTD-2313F11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
704-721
0.059
3
8mer
521-539
0.031
2
RP11-531F16.4
hsa-miR-93-5p
0.992

Gene Details
Chromosome: 3
Transcript: ENST00000608000
Biotype: antisense
Gene id: ENSG00000273261
Gene Name: RP11-531F16.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
101-123
0.083
4
6mer
395-415
0.006
3
LOC102467081
hsa-miR-93-5p
0.992

Gene Details
Chromosome: 5
Transcript: NR_104662.1
Biotype: sense
Gene id: NR_104662.1 (gene)
Gene Name: LOC102467081
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-93-5p
Sequence: caaagugcuguucgugcagguag
MirBase ID: MIMAT0000093
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
504-521
0.053
3
8mer
321-339
0.036
2
Funded by: