Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-99b-3p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
86322-86349
0.009
3
8mer
179755-179774
0.008
2
7mer
88359-88376
0.005
5
7mer
151313-151331
0.005
1
7mer
7152-7177
0.004
4
6mer
60026-60041
0.004
9
7mer
62517-62538
0.003
2
7mer
54825-54851
0.003
1
7mer
90811-90831
0.003
1
7mer
22500-22511
0.003
2
7mer
106929-106949
0.003
2
7mer
84359-84374
0.003
3
6mer
75853-75866
0.003
5
6mer
128664-128678
0.003
8
6mer
75158-75179
0.003
2
6mer
190723-190748
0.002
2
7mer
209483-209505
0.002
2
7mer
75275-75291
0.002
1
6mer
2908-2926
0.002
4
6mer
167184-167209
0.002
1
7mer
135165-135182
0.002
2
6mer
48043-48062
0.002
2
6mer
119337-119362
0.002
9
7mer
139586-139601
0.002
2
6mer
194882-194900
0.002
2
6mer
82955-82973
0.002
6
6mer
31183-31206
0.002
2
6mer
208739-208758
0.002
4
7mer
45599-45622
0.002
2
6mer
9580-9599
0.002
4
6mer
57591-57616
0.002
2
6mer
78734-78761
0.002
2
6mer
181884-181898
0.002
3
6mer
200884-200902
0.002
2
6mer
111571-111592
0.002
4
6mer
102130-102150
0.002
7
7mer
29591-29606
0.002
2
6mer
71068-71090
0.002
1
6mer
11989-12014
0.002
3
6mer
158641-158666
0.002
3
6mer
144781-144801
0.002
6
6mer
53649-53664
0.002
5
6mer
117687-117704
0.002
4
6mer
61411-61436
0.002
4
6mer
163953-163967
0.002
3
6mer
182540-182565
0.002
2
6mer
56072-56089
0.002
3
6mer
3335-3359
0.002
4
6mer
214135-214147
0.002
2
6mer
12255-12274
0.001
1
6mer
125494-125509
0.001
4
7mer
241732-241751
0.001
2
6mer
96937-96950
0.001
5
7mer
118443-118460
0.001
1
7mer
112414-112434
0.001
1
6mer
147436-147460
0.001
2
6mer
152333-152358
0.001
2
6mer
212618-212644
0.001
2
7mer
65150-65166
0.001
1
6mer
201082-201107
0.001
1
6mer
242535-242559
0.001
2
6mer
207302-207325
0.001
2
7mer
73227-73252
0.001
1
6mer
182947-182969
0.001
3
6mer
186698-186719
0.001
2
7mer
84728-84750
0.001
3
6mer
250827-250842
0.001
Not Conserved
6mer
31561-31574
0.001
3
6mer
236411-236430
0.001
1
6mer
6094-6115
0.001
2
6mer
95801-95821
0.001
3
6mer
204560-204586
0.001
2
6mer
140780-140795
0.001
1
6mer
189061-189080
0.001
1
6mer
56819-56840
0.001
2
6mer
95176-95196
0.001
2
6mer
261942-261958
0.001
2
6mer
150272-150287
0.001
3
6mer
23409-23424
0.001
3
6mer
254157-254175
0.001
3
6mer
146120-146143
0.001
1
6mer
88716-88741
0.001
2
6mer
220206-220225
0.001
3
6mer
264274-264293
0.001
2
6mer
260129-260152
0.001
2
6mer
96463-96490
0.001
3
6mer
16372-16398
0.001
2
6mer
66338-66354
0.001
2
6mer
108532-108558
0.001
2
6mer
69685-69703
0.001
2
6mer
145977-145995
0.001
2
6mer
28961-28984
0.001
1
6mer
155532-155558
0.001
2
6mer
153588-153606
0.001
1
6mer
246649-246666
0.001
1
6mer
145327-145348
0.001
2
6mer
259901-259926
0.001
2
6mer
49799-49825
0.001
2
6mer
185803-185826
0.001
2
7mer
253566-253591
0.001
2
6mer
247909-247935
0.001
1
6mer
118640-118660
0.001
1
6mer
170843-170860
0.001
2
6mer
241945-241963
0.001
1
7mer
181330-181352
0.001
Not Conserved
6mer
1803-1823
0.001
2
6mer
59414-59434
0.001
2
6mer
235652-235677
0.001
2
7mer
187283-187305
0.001
1
7mer
213458-213480
0.001
1
6mer
144810-144836
0.001
6
7mer
231223-231245
0.001
1
6mer
227473-227491
0.001
Not Conserved
6mer
107287-107312
0.001
Not Conserved
6mer
180624-180648
0.001
1
7mer
263282-263307
0.001
1
6mer
101825-101843
0.001
2
6mer
183070-183093
0.001
1
6mer
259991-260008
0.000
2
6mer
75884-75900
0.000
2
XLOC_013703
hsa-miR-99b-3p
0.999

Gene Details
Chromosome: chr20
Transcript: TCONS_00028028
Biotype: transcript isomorph
Gene id: XLOC_013703
Gene Name: XLOC_013703
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
201-226
0.098
1
6mer
62-81
0.017
1
6mer
1379-1401
0.010
1
RP11-474I11.7
hsa-miR-99b-3p
0.997

Gene Details
Chromosome: 17
Transcript: ENST00000585020
Biotype: antisense
Gene id: ENSG00000264270
Gene Name: RP11-474I11.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
118-142
0.083
2
8mer
455-468
0.025
2
RP11-474I11.7
hsa-miR-99b-3p
0.985

Gene Details
Chromosome: 17
Transcript: ENST00000582093
Biotype: antisense
Gene id: ENSG00000264270
Gene Name: RP11-474I11.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
123-147
0.079
2
RP4-715N11.2
hsa-miR-99b-3p
0.984

Gene Details
Chromosome: 20
Transcript: ENST00000448013
Biotype: lincRNA
Gene id: ENSG00000232294
Gene Name: RP4-715N11.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
145-166
0.078
9
RP4-715N11.2
hsa-miR-99b-3p
0.979

Gene Details
Chromosome: 20
Transcript: ENST00000421642
Biotype: lincRNA
Gene id: ENSG00000232294
Gene Name: RP4-715N11.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
282-303
0.074
9
RP4-715N11.2
hsa-miR-99b-3p
0.977

Gene Details
Chromosome: 20
Transcript: ENST00000425279
Biotype: lincRNA
Gene id: ENSG00000232294
Gene Name: RP4-715N11.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
145-166
0.072
9
LINC01189
hsa-miR-99b-3p
0.973

Gene Details
Chromosome: 9
Transcript: ENST00000428440
Biotype: lincRNA
Gene id: ENSG00000232827
Gene Name: LINC01189
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
306-320
0.067
2
6mer
2366-2380
0.002
Not Conserved
KCNQ1OT1
hsa-miR-99b-3p
0.944

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
8052-8075
0.012
1
7mer
73838-73862
0.005
4
7mer
76049-76066
0.003
1
7mer
53530-53552
0.002
1
6mer
19184-19201
0.002
2
6mer
45096-45117
0.002
2
6mer
13210-13232
0.002
2
6mer
26844-26866
0.002
1
6mer
33298-33323
0.002
1
6mer
78010-78025
0.002
2
7mer
61589-61611
0.002
1
6mer
24128-24147
0.002
2
7mer
55651-55673
0.001
4
6mer
19659-19682
0.001
2
6mer
58442-58465
0.001
2
6mer
84563-84585
0.001
2
6mer
43639-43650
0.001
2
7mer
55514-55540
0.001
3
6mer
66533-66547
0.001
1
6mer
64886-64905
0.001
3
6mer
86669-86691
0.001
3
6mer
83101-83122
0.001
2
6mer
58594-58619
0.001
2
6mer
56739-56760
0.001
1
6mer
80903-80920
0.001
2
6mer
82679-82701
0.001
2
6mer
65450-65467
0.001
1
6mer
17293-17313
0.001
2
6mer
56337-56361
0.001
2
6mer
56661-56681
0.001
5
6mer
56721-56747
0.000
2
AC006548.28
hsa-miR-99b-3p
0.942

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
83489-83509
0.008
2
8mer
58170-58193
0.005
2
6mer
550-575
0.003
2
7mer
22979-22999
0.002
3
6mer
21543-21563
0.002
4
7mer
2329-2352
0.002
2
6mer
33878-33898
0.002
2
6mer
70529-70550
0.002
1
6mer
70907-70928
0.002
1
6mer
55376-55399
0.002
2
6mer
74688-74702
0.002
1
7mer
15063-15088
0.002
2
6mer
78648-78671
0.002
1
6mer
29543-29566
0.001
1
6mer
2907-2920
0.001
4
6mer
22364-22375
0.001
3
6mer
17533-17559
0.001
3
7mer
36201-36219
0.001
2
6mer
21227-21252
0.001
1
6mer
4550-4566
0.001
1
6mer
63019-63034
0.001
2
6mer
25159-25171
0.001
2
6mer
40057-40081
0.001
2
6mer
35453-35469
0.001
2
6mer
5633-5647
0.001
1
6mer
62793-62809
0.001
1
6mer
16095-16115
0.001
2
6mer
3882-3901
0.001
1
6mer
60866-60880
0.001
2
6mer
39648-39671
0.001
2
7mer
66716-66741
0.001
1
6mer
5806-5824
0.001
1
6mer
10646-10660
0.001
1
6mer
9712-9731
0.001
1
LINC00662
hsa-miR-99b-3p
0.936

Gene Details
Chromosome: 19
Transcript: NR_027301.1
Biotype: lincRNA
Gene id: NR_027301.1 (gene)
Gene Name: LINC00662
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
291-317
0.015
1
7mer
1781-1806
0.015
1
6mer
1741-1767
0.013
1
6mer
451-474
0.011
1
LINC00662
hsa-miR-99b-3p
0.934

Gene Details
Chromosome: 19
Transcript: ENST00000590523
Biotype: lincRNA
Gene id: ENSG00000261824
Gene Name: LINC00662
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
293-319
0.015
1
7mer
1783-1808
0.015
1
6mer
1743-1769
0.013
1
6mer
453-476
0.011
1
KB-68A7.2
hsa-miR-99b-3p
0.926

Gene Details
Chromosome: 21
Transcript: ENST00000622854
Biotype: lincRNA
Gene id: ENSG00000277352
Gene Name: KB-68A7.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
429-454
0.052
2
RP11-363G2.4
hsa-miR-99b-3p
0.926

Gene Details
Chromosome: 13
Transcript: ENST00000445646
Biotype: lincRNA
Gene id: ENSG00000229556
Gene Name: RP11-363G2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1805-1819
0.021
1
6mer
32-46
0.018
1
6mer
113-137
0.013
1
XLOC_000147
hsa-miR-99b-3p
0.926

Gene Details
Chromosome: chr1
Transcript: TCONS_00000894
Biotype: transcript isomorph
Gene id: XLOC_000147
Gene Name: XLOC_000147
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
358-375
0.052
12
RP11-261N11.8
hsa-miR-99b-3p
0.913

Gene Details
Chromosome: 20
Transcript: ENST00000428531
Biotype: antisense
Gene id: ENSG00000203900
Gene Name: RP11-261N11.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
492-511
0.049
2
MIR4534
hsa-miR-99b-3p
0.904

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
6665-6684
0.006
2
7mer
44622-44646
0.005
4
7mer
17844-17859
0.003
2
7mer
45097-45121
0.003
2
7mer
50984-51000
0.003
2
7mer
11284-11298
0.002
2
7mer
34995-35016
0.002
8
7mer
38524-38543
0.002
2
7mer
6165-6185
0.002
1
6mer
22617-22638
0.001
4
6mer
51675-51695
0.001
3
6mer
34323-34342
0.001
1
6mer
3478-3492
0.001
1
6mer
13061-13074
0.001
1
6mer
51872-51897
0.001
2
6mer
16536-16553
0.001
3
6mer
45807-45823
0.001
2
6mer
16037-16053
0.001
2
6mer
43953-43977
0.001
2
6mer
46965-46982
0.001
1
7mer
21859-21881
0.001
2
6mer
36752-36777
0.001
2
7mer
48158-48177
0.001
2
6mer
14739-14756
0.001
1
6mer
49622-49642
0.001
2
7mer
45554-45576
0.001
1
6mer
5833-5849
0.001
2
6mer
40529-40546
0.001
2
7mer
35053-35072
0.001
3
6mer
48801-48823
0.000
1
AC008277.1
hsa-miR-99b-3p
0.902

Gene Details
Chromosome: 2
Transcript: ENST00000594921
Biotype: antisense
Gene id: ENSG00000223642
Gene Name: AC008277.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
343-367
0.047
8
XLOC_008323
hsa-miR-99b-3p
0.897

Gene Details
Chromosome: chrY
Transcript: TCONS_00017647
Biotype: transcript isomorph
Gene id: XLOC_008323
Gene Name: XLOC_008323
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
317-332
0.046
1
AC006116.15
hsa-miR-99b-3p
0.891

Gene Details
Chromosome: 19
Transcript: ENST00000593258
Biotype: sense_intronic
Gene id: ENSG00000267429
Gene Name: AC006116.15
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
782-800
0.045
1
Funded by: