Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-99b-5p
0.862

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
237717-237738
0.004
1
7mer
88563-88579
0.003
1
6mer
227954-227980
0.002
1
6mer
254679-254703
0.002
3
6mer
18950-18970
0.002
1
7mer
22109-22135
0.001
1
6mer
14273-14280
0.001
1
6mer
68832-68843
0.001
1
6mer
64991-65008
0.001
2
6mer
122210-122220
0.001
1
6mer
38267-38284
0.001
1
6mer
211326-211348
0.001
1
6mer
120655-120675
0.001
3
6mer
231628-231644
0.001
1
6mer
181130-181138
0.001
Not Conserved
6mer
180638-180660
0.001
1
6mer
256611-256631
0.001
1
6mer
51503-51522
0.001
2
6mer
242130-242152
0.001
2
6mer
229178-229195
0.001
1
6mer
213300-213317
0.001
1
6mer
102856-102875
0.001
1
6mer
206685-206703
0.001
1
6mer
259858-259874
0.001
Not Conserved
6mer
141512-141538
0.001
3
6mer
11473-11490
0.001
1
6mer
85575-85592
0.001
Not Conserved
6mer
202806-202823
0.001
Not Conserved
7mer
100561-100582
0.001
Not Conserved
6mer
234400-234418
0.001
1
6mer
214419-214444
0.001
1
6mer
74529-74550
0.001
2
6mer
206091-206099
0.001
Not Conserved
6mer
121259-121276
0.001
1
6mer
120201-120222
0.001
3
6mer
51548-51571
0.001
1
6mer
100745-100761
0.000
1
7mer
206131-206148
0.000
Not Conserved
DLGAP1-AS2
hsa-miR-99b-5p
0.829

Gene Details
Chromosome: 18
Transcript: ENST00000572856
Biotype: antisense
Gene id: ENSG00000262001
Gene Name: DLGAP1-AS2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
607-624
0.031
Not Conserved
6mer
2103-2107
0.005
2
RP11-513I15.6
hsa-miR-99b-5p
0.814

Gene Details
Chromosome: 6
Transcript: ENST00000429998
Biotype: retained_intron
Gene id: ENSG00000225339
Gene Name: RP11-513I15.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
141-163
0.034
2
6mer
3262-3281
0.001
Not Conserved
LINC00955
hsa-miR-99b-5p
0.789

Gene Details
Chromosome: 4
Transcript: ENST00000502775
Biotype: retained_intron
Gene id: ENSG00000216560
Gene Name: LINC00955
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
205-223
0.032
Not Conserved
RP11-157B13.8
hsa-miR-99b-5p
0.786

Gene Details
Chromosome: 19
Transcript: ENST00000601905
Biotype: lincRNA
Gene id: ENSG00000268597
Gene Name: RP11-157B13.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
329-348
0.032
2
RP11-81F13.2
hsa-miR-99b-5p
0.781

Gene Details
Chromosome: 14
Transcript: ENST00000557642
Biotype: antisense
Gene id: ENSG00000258601
Gene Name: RP11-81F13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
416-441
0.031
2
XLOC_013308
hsa-miR-99b-5p
0.759

Gene Details
Chromosome: chr19
Transcript: TCONS_00027309
Biotype: transcript isomorph
Gene id: XLOC_013308
Gene Name: XLOC_013308
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
54-65
0.027
2
6mer
634-646
0.003
1
RP11-379L18.1
hsa-miR-99b-5p
0.744

Gene Details
Chromosome: 18
Transcript: ENST00000587528
Biotype: antisense
Gene id: ENSG00000267746
Gene Name: RP11-379L18.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
181-204
0.028
10
PROX1-AS1
hsa-miR-99b-5p
0.714

Gene Details
Chromosome: 1
Transcript: ENST00000607258
Biotype: antisense
Gene id: ENSG00000272167
Gene Name: PROX1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1068-1089
0.026
11
RP11-374M1.2
hsa-miR-99b-5p
0.703

Gene Details
Chromosome: 9
Transcript: ENST00000439760
Biotype: lincRNA
Gene id: ENSG00000231527
Gene Name: RP11-374M1.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
617-629
0.018
2
6mer
174-191
0.007
1
RP11-611O2.5
hsa-miR-99b-5p
0.702

Gene Details
Chromosome: 12
Transcript: ENST00000553141
Biotype: antisense
Gene id: ENSG00000257181
Gene Name: RP11-611O2.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
205-222
0.020
1
6mer
106-128
0.005
1
FLJ37035
hsa-miR-99b-5p
0.700

Gene Details
Chromosome: 10
Transcript: NR_033847.1
Biotype: lincRNA
Gene id: NR_033847.1 (gene)
Gene Name: FLJ37035
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1532-1554
0.025
1
Funded by: