Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-107
hsa-let-7a-5p
Clear all

ENSG00000279978
XLOC_012138
ENSG00000280156
Clear all
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-let-7a-5p
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7a-5p
Sequence: ugagguaguagguuguauaguu
MirBase ID: MIMAT0000062
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
120017-120029
0.050
14
8mer
231890-231916
0.014
Not Conserved
8mer
186250-186277
0.009
1
7mer
187681-187700
0.009
1
7mer
232112-232137
0.008
1
8mer
91386-91404
0.007
2
8mer
230544-230569
0.007
1
7mer
224743-224755
0.007
2
7mer
57645-57672
0.006
4
8mer+wobble
162340-162360
0.006
1
7mer
216013-216039
0.005
8
8mer
252952-252974
0.005
3
7mer
53457-53474
0.005
1
7mer
191030-191046
0.005
3
7mer
35759-35779
0.005
1
7mer
130199-130216
0.004
7
7mer
33528-33543
0.004
2
7mer
206678-206696
0.004
3
8mer
180384-180396
0.004
1
7mer
167229-167247
0.004
2
8mer+mismatch
267015-267038
0.004
2
7mer
146043-146067
0.003
1
7mer
174027-174047
0.003
2
8mer
108228-108249
0.003
1
7mer
111017-111032
0.003
1
7mer
24497-24517
0.003
1
7mer
19139-19164
0.003
2
7mer
33402-33417
0.003
6
6mer
101204-101222
0.003
9
6mer
128699-128715
0.003
9
6mer
126552-126572
0.003
7
8mer
158223-158245
0.002
2
7mer
185845-185858
0.002
1
6mer
40485-40505
0.002
4
7mer
233279-233294
0.002
1
6mer
208486-208503
0.002
8
6mer
56298-56322
0.002
4
6mer
3656-3671
0.002
3
6mer
220469-220483
0.002
3
7mer
96955-96978
0.002
2
6mer
9841-9866
0.002
7
6mer
9099-9108
0.002
1
7mer
213969-213990
0.002
4
6mer
201222-201243
0.002
1
6mer
264825-264829
0.002
1
7mer
104969-104990
0.002
3
7mer
42071-42092
0.002
2
6mer
42010-42035
0.002
2
6mer
177679-177695
0.002
2
6mer
154181-154206
0.002
Not Conserved
6mer
184592-184610
0.002
1
6mer
3249-3272
0.002
4
6mer
135330-135357
0.002
4
6mer
77880-77904
0.002
1
6mer
149122-149143
0.002
4
6mer
70133-70157
0.002
4
6mer
168935-168954
0.002
1
6mer
11903-11925
0.002
2
7mer
148857-148877
0.002
1
6mer
94359-94375
0.002
2
6mer
132905-132920
0.001
1
6mer
21705-21729
0.001
3
6mer
85960-85987
0.001
3
6mer
154605-154630
0.001
2
6mer
21046-21072
0.001
3
6mer
187856-187882
0.001
2
6mer
103570-103581
0.001
2
6mer
129647-129668
0.001
2
6mer
113794-113818
0.001
4
6mer
33104-33131
0.001
2
6mer
20528-20543
0.001
Not Conserved
6mer
38793-38811
0.001
2
6mer
96874-96888
0.001
2
6mer
111742-111757
0.001
2
6mer
53244-53266
0.001
2
6mer
223935-223948
0.001
2
6mer
77398-77423
0.001
1
6mer
100864-100885
0.001
1
6mer
205655-205674
0.001
3
6mer
162135-162160
0.001
3
6mer
264486-264504
0.001
2
6mer
221006-221033
0.001
2
6mer
155157-155183
0.001
2
6mer
255486-255509
0.001
2
6mer
69706-69730
0.001
4
6mer
128405-128416
0.001
1
6mer
103896-103921
0.001
2
6mer
207995-208010
0.001
1
6mer
178684-178706
0.001
2
6mer
52587-52612
0.001
1
6mer
143413-143435
0.001
2
6mer
231490-231516
0.001
1
6mer
205932-205955
0.001
1
6mer
247537-247551
0.001
1
6mer
237469-237489
0.001
2
6mer
94992-95015
0.001
2
6mer
71483-71506
0.001
2
6mer
255264-255279
0.001
2
6mer
157575-157598
0.001
2
6mer
243261-243275
0.001
1
6mer
68925-68946
0.001
2
6mer
126111-126134
0.001
2
6mer
59724-59736
0.001
1
6mer
80679-80702
0.001
1
6mer
131276-131299
0.001
2
6mer
66538-66564
0.001
Not Conserved
6mer
247210-247226
0.001
1
6mer
172757-172767
0.001
3
6mer
239932-239951
0.001
2
6mer
104880-104895
0.001
2
6mer
88476-88491
0.001
2
6mer
133878-133901
0.001
1
6mer
117786-117799
0.001
2
8mer
111037-111059
0.001
1
6mer
195769-195782
0.001
1
6mer
51217-51242
0.001
2
6mer
93114-93135
0.001
2
6mer
233638-233663
0.001
2
6mer
6258-6279
0.001
2
6mer
175665-175678
0.001
3
6mer
76222-76245
0.001
2
6mer
127826-127840
0.001
Not Conserved
6mer
28355-28371
0.001
2
6mer
138431-138445
0.001
1
6mer
156638-156663
0.001
2
6mer
91498-91521
0.001
1
6mer
233840-233866
0.001
2
6mer
111860-111879
0.001
1
6mer
201882-201905
0.001
Not Conserved
6mer
245044-245069
0.001
1
6mer
110191-110214
0.001
2
6mer
252612-252634
0.001
2
6mer
64218-64240
0.001
2
6mer
186280-186297
0.001
3
6mer
208557-208570
0.001
5
6mer
61218-61242
0.001
1
6mer
41608-41623
0.001
2
6mer
97259-97282
0.001
2
6mer
170124-170147
0.001
2
6mer
18988-19011
0.001
2
6mer
36892-36915
0.001
2
6mer
70690-70705
0.001
2
6mer
136571-136594
0.001
2
6mer
137636-137662
0.001
2
6mer
233394-233410
0.001
2
6mer
137459-137477
0.001
2
6mer
261366-261389
0.001
1
6mer
160983-161006
0.001
2
6mer
143619-143641
0.001
4
6mer
65670-65692
0.001
1
6mer
120046-120072
0.001
9
6mer
230561-230584
0.001
1
6mer
247638-247660
0.001
1
6mer
143486-143503
0.000
2
6mer
143552-143572
0.000
3
6mer
19169-19191
0.000
2
6mer
233405-233428
0.000
Not Conserved
6mer
174051-174073
0.000
2
chr22-38_28785274-29006793.1
hsa-miR-107
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-107
Sequence: agcagcauuguacagggcuauca
MirBase ID: MIMAT0000104
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
17090-17114
0.017
3
8mer
9911-9933
0.008
2
8mer
16822-16839
0.007
1
8mer
210932-210949
0.007
Not Conserved
8mer
61279-61302
0.007
1
7mer
42343-42364
0.006
2
7mer
120307-120321
0.005
13
7mer
126671-126696
0.005
6
7mer
76880-76896
0.005
2
8mer
131445-131468
0.005
2
7mer
165233-165260
0.004
1
7mer
130989-131008
0.004
2
7mer
66573-66593
0.004
2
6mer
123810-123829
0.004
10
7mer
55564-55586
0.004
4
7mer
83640-83657
0.004
3
8mer
171503-171527
0.004
2
8mer
259249-259270
0.004
2
8mer
265418-265443
0.004
Not Conserved
6mer
119551-119574
0.003
9
7mer
123064-123084
0.003
Not Conserved
7mer
99424-99434
0.003
4
8mer
72094-72116
0.003
2
7mer
35336-35359
0.003
4
7mer
99672-99683
0.003
2
7mer
261018-261033
0.003
1
7mer
120105-120120
0.003
11
7mer
178317-178325
0.003
Not Conserved
7mer
195021-195046
0.003
2
7mer
109879-109902
0.003
1
7mer
259719-259744
0.003
Not Conserved
6mer
88614-88636
0.003
4
6mer
117621-117638
0.003
3
7mer
33562-33589
0.003
Not Conserved
8mer
224248-224265
0.003
1
9mer
261038-261059
0.003
1
6mer
82925-82946
0.002
2
8mer
103912-103937
0.002
1
6mer
150092-150112
0.002
9
6mer
104292-104316
0.002
6
6mer
55275-55289
0.002
6
8mer
7451-7462
0.002
2
6mer
57560-57578
0.002
6
7mer
118882-118907
0.002
2
6mer
88013-88036
0.002
2
6mer
100177-100186
0.002
5
6mer
181622-181635
0.002
4
7mer
179947-179965
0.002
1
6mer
75533-75558
0.002
5
7mer
124539-124563
0.002
4
8mer
150606-150626
0.002
2
7mer
264867-264879
0.002
1
6mer
156093-156120
0.002
2
6mer
12933-12947
0.002
9
7mer
20155-20165
0.002
2
6mer
118231-118251
0.002
9
6mer
74838-74864
0.002
5
8mer
2344-2371
0.002
2
6mer
52967-52991
0.002
4
6mer
58425-58438
0.002
5
6mer
226716-226742
0.002
1
6mer
100247-100264
0.002
8
6mer
6783-6806
0.002
3
7mer
62816-62833
0.002
Not Conserved
6mer
53777-53790
0.002
5
6mer
57722-57743
0.002
4
6mer
119712-119730
0.002
10
6mer
197218-197245
0.002
2
6mer
178499-178526
0.002
5
6mer
204562-204577
0.002
1
6mer
266161-266185
0.002
2
6mer
188209-188234
0.001
2
6mer
95108-95130
0.001
2
6mer
54782-54801
0.001
5
6mer
13070-13088
0.001
9
6mer
136381-136400
0.001
2
6mer
125476-125494
0.001
7
6mer
25950-25971
0.001
4
6mer
86540-86562
0.001
3
6mer
124113-124140
0.001
2
6mer
176771-176795
0.001
5
6mer
120349-120372
0.001
9
6mer
231406-231428
0.001
1
7mer
150602-150629
0.001
4
6mer
18054-18077
0.001
1
6mer
61700-61724
0.001
1
6mer
93434-93447
0.001
2
6mer
29095-29112
0.001
5
6mer
206575-206594
0.001
1
6mer
215543-215569
0.001
3
6mer
120612-120626
0.001
4
6mer
211527-211551
0.001
3
6mer
260005-260030
0.001
3
6mer
222721-222741
0.001
2
7mer
90247-90266
0.001
1
6mer
117242-117268
0.001
2
6mer
74586-74606
0.001
4
7mer
256025-256038
0.001
1
6mer
223276-223302
0.001
1
6mer
139218-139240
0.001
5
6mer
2201-2222
0.001
2
6mer
190471-190493
0.001
1
6mer
198840-198861
0.001
2
6mer
212059-212076
0.001
2
6mer
5440-5457
0.001
1
6mer
84242-84265
0.001
2
6mer
226434-226452
0.001
2
6mer
23948-23971
0.001
2
6mer
115858-115881
0.001
2
7mer
218920-218942
0.001
1
6mer
150863-150882
0.001
1
6mer
93305-93328
0.001
2
6mer
209914-209934
0.001
2
6mer
49244-49270
0.001
2
7mer
7451-7465
0.001
2
6mer
242250-242259
0.001
2
6mer
185844-185867
0.001
1
6mer
246524-246541
0.001
1
6mer
128859-128874
0.001
4
6mer
166942-166962
0.001
1
6mer
140147-140173
0.001
2
7mer
103915-103940
0.001
2
6mer
188365-188384
0.001
1
6mer
149315-149338
0.001
Not Conserved
6mer
54114-54127
0.001
2
6mer
214234-214258
0.001
2
6mer
21915-21936
0.001
2
7mer
185855-185873
0.001
2
6mer
18150-18171
0.001
2
6mer
212449-212467
0.001
2
6mer
13096-13115
0.001
8
6mer
72290-72302
0.001
2
6mer
105571-105595
0.001
1
6mer
117693-117718
0.001
3
6mer
125365-125386
0.001
2
7mer
2348-2374
0.001
1
6mer
246641-246650
0.001
1
6mer
120105-120122
0.001
8
6mer
242385-242407
0.001
2
6mer
104637-104658
0.001
2
7mer
72094-72119
0.001
2
6mer
120426-120435
0.001
5
6mer
83026-83050
0.001
2
6mer
178511-178528
0.001
5
6mer
74960-74974
0.001
3
6mer
234838-234863
0.001
1
6mer
213407-213432
0.001
1
6mer
74960-74976
0.000
3
7mer
185855-185870
0.000
1
6mer
259249-259272
0.000
1
7mer
12933-12950
0.000
3
6mer
29095-29114
0.000
5
6mer
256039-256066
0.000
1
6mer
242267-242281
0.000
Not Conserved
6mer
95139-95160
0.000
1
6mer
256042-256068
0.000
1
6mer
104644-104666
0.000
2
6mer
242318-242335
0.000
Not Conserved
6mer
211563-211573
0.000
1
6mer
140152-140175
0.000
2
6mer
242267-242283
0.000
Not Conserved
XLOC_012138
hsa-let-7a-5p
0.999

Gene Details
Chromosome: chr17
Transcript: TCONS_00025860
Biotype: transcript isomorph
Gene id: XLOC_012138
Gene Name: XLOC_012138
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-let-7a-5p
Sequence: ugagguaguagguuguauaguu
MirBase ID: MIMAT0000062
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
688-705
0.127
1
AC006548.28
hsa-miR-107
0.999

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-107
Sequence: agcagcauuguacagggcuauca
MirBase ID: MIMAT0000104
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25541-25565
0.012
2
8mer
51063-51080
0.011
Not Conserved
8mer
68148-68168
0.009
1
7mer
28722-28743
0.007
2
7mer
16869-16891
0.006
2
7mer
31206-31228
0.006
Not Conserved
7mer
3842-3859
0.006
2
7mer
42263-42286
0.004
3
7mer
38736-38749
0.004
1
7mer
23095-23110
0.002
2
6mer
14243-14254
0.002
3
8mer
6726-6750
0.002
1
7mer
20585-20601
0.002
2
7mer
37470-37497
0.002
2
7mer
59636-59658
0.002
1
7mer
2389-2415
0.002
2
6mer
17569-17592
0.002
2
7mer
16692-16717
0.002
2
7mer
7335-7352
0.002
1
6mer
56840-56852
0.002
2
6mer
24406-24427
0.002
6
6mer
74593-74611
0.002
1
6mer
67740-67762
0.002
Not Conserved
6mer
17269-17287
0.002
1
7mer
11915-11937
0.001
1
6mer
30991-31006
0.001
1
6mer
36837-36852
0.001
3
6mer
74834-74847
0.001
1
6mer
25840-25850
0.001
1
6mer
10373-10392
0.001
2
6mer
70674-70688
0.001
Not Conserved
6mer
14008-14033
0.001
2
7mer
22271-22283
0.001
Not Conserved
6mer
8588-8604
0.001
3
6mer
12599-12617
0.001
3
6mer
80109-80127
0.001
1
6mer
5226-5240
0.001
2
6mer
67235-67249
0.001
1
7mer
19584-19599
0.001
1
6mer
71614-71641
0.001
Not Conserved
6mer
61389-61413
0.001
Not Conserved
7mer
20470-20494
0.001
2
6mer
52661-52680
0.001
Not Conserved
6mer
8071-8094
0.001
2
6mer
12076-12098
0.001
3
6mer
38284-38298
0.001
2
6mer
10625-10649
0.001
2
6mer
12916-12936
0.001
2
6mer
13546-13567
0.001
1
6mer
82021-82044
0.001
2
6mer
45038-45057
0.001
1
6mer
17105-17123
0.001
2
6mer
38018-38028
0.001
Not Conserved
6mer
17187-17205
0.001
1
7mer
23092-23110
0.001
1
6mer
17846-17868
0.001
1
6mer
19582-19599
0.000
1
6mer
22269-22285
0.000
3
AC006548.28
hsa-let-7a-5p
0.960

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-let-7a-5p
Sequence: ugagguaguagguuguauaguu
MirBase ID: MIMAT0000062
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
69489-69510
0.016
1
7mer
73810-73826
0.005
1
7mer
7399-7422
0.004
1
8mer
14595-14615
0.003
1
6mer
521-538
0.003
1
7mer
68517-68531
0.003
1
6mer
58287-58310
0.002
1
6mer
68523-68543
0.002
1
6mer
34390-34415
0.001
2
6mer
59703-59718
0.001
2
6mer
83225-83238
0.001
2
6mer
77607-77623
0.001
1
6mer
16731-16747
0.001
1
6mer
54160-54176
0.001
Not Conserved
6mer
82999-83025
0.001
2
6mer
38575-38596
0.001
4
6mer
3430-3444
0.001
1
6mer
57401-57411
0.001
2
6mer
20245-20259
0.001
4
6mer
17488-17500
0.001
2
6mer
82201-82226
0.001
1
6mer
62769-62791
0.001
1
6mer
22965-22985
0.001
2
6mer
51712-51731
0.001
Not Conserved
6mer
21010-21032
0.001
2
6mer
8895-8909
0.001
Not Conserved
6mer
15715-15731
0.001
3
6mer
13264-13285
0.001
1
6mer
16076-16092
0.001
1
6mer
15591-15612
0.001
1
6mer
59560-59583
0.001
2
6mer
17418-17444
0.000
1
Funded by: