Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-451H23.3
hsa-miR-1287-5p
0.903

Gene Details
Chromosome: 5
Transcript: ENST00000513535
Biotype: lincRNA
Gene id: ENSG00000248717
Gene Name: RP11-451H23.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
752-777
0.032
1
7mer
725-747
0.015
1
RP11-344E13.3
hsa-miR-1287-5p
0.902

Gene Details
Chromosome: 17
Transcript: ENST00000443508
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
516-542
0.047
2
RP11-649E7.5
hsa-miR-1287-5p
0.901

Gene Details
Chromosome: 14
Transcript: ENST00000555043
Biotype: antisense
Gene id: ENSG00000258377
Gene Name: RP11-649E7.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
380-394
0.014
9
7mer
659-680
0.012
7
7mer
1380-1406
0.012
7
6mer
1011-1032
0.004
6
6mer
95-115
0.003
6
6mer
614-640
0.002
8
AC009404.2
hsa-miR-1287-5p
0.900

Gene Details
Chromosome: 2
Transcript: ENST00000439955
Biotype: lincRNA
Gene id: ENSG00000236255
Gene Name: AC009404.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
859-881
0.035
2
7mer
574-598
0.012
3
TRHDE-AS1
hsa-miR-1287-5p
0.899

Gene Details
Chromosome: 12
Transcript: ENST00000549957
Biotype: retained_intron
Gene id: ENSG00000236333
Gene Name: TRHDE-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4404-4419
0.025
6
7mer
4114-4141
0.022
2
XLOC_006753
hsa-miR-1287-5p
0.899

Gene Details
Chromosome: chr8
Transcript: TCONS_00015261
Biotype: transcript isomorph
Gene id: XLOC_006753
Gene Name: XLOC_006753
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4708-4732
0.028
3
8mer
2373-2396
0.010
1
6mer
6313-6337
0.003
5
6mer
4132-4153
0.002
2
6mer
2132-2153
0.002
2
6mer
4451-4476
0.001
2
6mer
1448-1474
0.001
1
6mer
4268-4287
0.001
2
XLOC_004775
hsa-miR-1287-5p
0.899

Gene Details
Chromosome: chr5
Transcript: TCONS_00010297
Biotype: transcript isomorph
Gene id: XLOC_004775
Gene Name: XLOC_004775
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Liver Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
218-240
0.046
3
LINC00945
hsa-miR-1287-5p
0.898

Gene Details
Chromosome: 21
Transcript: ENST00000453716
Biotype: lincRNA
Gene id: ENSG00000232539
Gene Name: LINC00945
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
644-667
0.034
5
8mer
305-320
0.013
5
CASC15
hsa-miR-1287-5p
0.896

Gene Details
Chromosome: 6
Transcript: ENST00000606851
Biotype: lincRNA
Gene id: ENSG00000272168
Gene Name: CASC15
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1093-1113
0.026
2
7mer
715-733
0.011
4
6mer
467-491
0.006
6
6mer
1495-1521
0.003
1
RP4-798P15.3
hsa-miR-1287-5p
0.896

Gene Details
Chromosome: 1
Transcript: ENST00000354921
Biotype: processed_transcript
Gene id: ENSG00000254154
Gene Name: RP4-798P15.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2829-2855
0.009
9
7mer
4927-4949
0.009
2
7mer
3581-3606
0.007
9
6mer
4682-4700
0.006
8
6mer
4941-4957
0.005
8
6mer
3215-3233
0.003
9
7mer
3555-3579
0.002
7
6mer
3761-3788
0.002
2
6mer
2742-2766
0.001
12
6mer
2781-2797
0.001
10
7mer
1290-1310
0.001
1
6mer
1947-1971
0.001
1
6mer
1917-1933
0.000
3
6mer
1900-1917
0.000
3
AC007392.4
hsa-miR-1287-5p
0.895

Gene Details
Chromosome: 2
Transcript: ENST00000451698
Biotype: lincRNA
Gene id: ENSG00000237179
Gene Name: AC007392.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Colon Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
179-204
0.046
12
ZNF32-AS2
hsa-miR-1287-5p
0.894

Gene Details
Chromosome: 10
Transcript: ENST00000418966
Biotype: antisense
Gene id: ENSG00000230565
Gene Name: ZNF32-AS2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
142-166
0.029
9
7mer
85-102
0.013
6
6mer
568-582
0.003
2
RP11-474B16.1
hsa-miR-1287-5p
0.893

Gene Details
Chromosome: 12
Transcript: ENST00000549251
Biotype: antisense
Gene id: ENSG00000257642
Gene Name: RP11-474B16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
243-261
0.045
1
RP11-242F24.1
hsa-miR-1287-5p
0.893

Gene Details
Chromosome: 1
Transcript: ENST00000432429
Biotype: lincRNA
Gene id: ENSG00000228750
Gene Name: RP11-242F24.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1238-1260
0.034
1
6mer
86-105
0.008
8
6mer
734-760
0.002
Not Conserved
6mer
1102-1127
0.002
1
C3orf49
hsa-miR-1287-5p
0.893

Gene Details
Chromosome: 3
Transcript: NR_026866.1
Biotype: sense
Gene id: NR_026866.1 (gene)
Gene Name: C3orf49
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
166-186
0.023
5
7mer
700-715
0.013
3
6mer
309-333
0.006
6
6mer
403-415
0.003
4
XLOC_000223
hsa-miR-1287-5p
0.891

Gene Details
Chromosome: chr1
Transcript: TCONS_00000964
Biotype: transcript isomorph
Gene id: XLOC_000223
Gene Name: XLOC_000223
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
279-291
0.045
6
XLOC_001173
hsa-miR-1287-5p
0.891

Gene Details
Chromosome: chr1
Transcript: TCONS_00002568
Biotype: transcript isomorph
Gene id: XLOC_001173
Gene Name: XLOC_001173
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
352-377
0.029
3
7mer
274-296
0.016
5
MIR3663HG
hsa-miR-1287-5p
0.891

Gene Details
Chromosome: 10
Transcript: ENST00000419373
Biotype: lincRNA
Gene id: ENSG00000234474
Gene Name: MIR3663HG
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
814-836
0.034
5
6mer
261-276
0.005
4
6mer
1740-1761
0.003
2
6mer
1195-1214
0.002
5
6mer
2350-2370
0.002
1
RP11-208N14.4
hsa-miR-1287-5p
0.890

Gene Details
Chromosome: 3
Transcript: ENST00000356133
Biotype: antisense
Gene id: ENSG00000198491
Gene Name: RP11-208N14.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1603-1621
0.015
10
7mer
1789-1807
0.007
7
8mer
1220-1244
0.007
4
6mer
2086-2106
0.004
2
6mer
2378-2396
0.003
1
6mer
1458-1485
0.002
10
6mer
1867-1886
0.002
2
6mer
2402-2422
0.002
1
6mer
1586-1596
0.002
8
6mer
1066-1084
0.001
5
6mer
1168-1184
0.001
1
RP11-362A9.3
hsa-miR-1287-5p
0.890

Gene Details
Chromosome: 3
Transcript: ENST00000463255
Biotype: antisense
Gene id: ENSG00000243305
Gene Name: RP11-362A9.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
263-281
0.031
7
6mer
34-60
0.014
11
Funded by: