Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
ZMYM4-AS1
hsa-miR-1287-5p
0.995

Gene Details
Chromosome: 1
Transcript: ENST00000432683
Biotype: antisense
Gene id: ENSG00000227409
Gene Name: ZMYM4-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
216-232
0.098
10
AC006946.16
hsa-miR-1287-5p
0.995

Gene Details
Chromosome: 22
Transcript: ENST00000608373
Biotype: lincRNA
Gene id: ENSG00000273203
Gene Name: AC006946.16
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2642-2658
0.071
2
7mer
1045-1062
0.015
2
8mer
1298-1320
0.010
2
6mer
2187-2202
0.003
1
AC006548.28
hsa-miR-1287-5p
0.995

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
50825-50844
0.006
Not Conserved
7mer
56277-56296
0.006
2
7mer
41726-41750
0.005
2
7mer
75173-75198
0.005
Not Conserved
6mer
685-711
0.004
2
8mer
12971-12992
0.003
2
7mer
82409-82434
0.002
1
7mer
58080-58098
0.002
1
6mer
68894-68914
0.002
1
7mer
3477-3504
0.002
1
6mer
19109-19132
0.002
1
6mer
30787-30810
0.002
2
6mer
56636-56656
0.002
2
7mer
36788-36806
0.002
1
6mer
83217-83241
0.002
1
6mer
79904-79924
0.002
1
6mer
43560-43579
0.002
4
8mer+wobble
9302-9322
0.002
1
6mer
29008-29020
0.002
2
6mer
3641-3659
0.002
2
6mer
55485-55496
0.002
2
6mer
38032-38051
0.002
6
6mer
20032-20058
0.002
2
6mer
4092-4111
0.001
2
6mer
14760-14782
0.001
3
6mer
10269-10290
0.001
3
6mer
15184-15202
0.001
2
6mer
64564-64582
0.001
1
6mer
35054-35069
0.001
2
6mer
1785-1804
0.001
2
6mer
13706-13724
0.001
5
6mer
34358-34378
0.001
1
6mer
12440-12458
0.001
2
6mer
58573-58592
0.001
2
6mer
14213-14225
0.001
2
6mer
64875-64900
0.001
2
6mer
35935-35959
0.001
2
6mer
42680-42703
0.001
1
6mer
48573-48591
0.001
Not Conserved
6mer
82670-82696
0.001
2
6mer
18275-18294
0.001
1
6mer
7796-7815
0.001
2
6mer
6420-6436
0.001
2
6mer
81416-81436
0.001
1
6mer
63014-63037
0.001
2
6mer
61849-61876
0.001
1
6mer
15694-15720
0.001
2
6mer
13649-13671
0.001
10
6mer
10146-10166
0.001
2
6mer
48941-48958
0.001
Not Conserved
6mer
17086-17109
0.001
2
6mer
66683-66701
0.001
1
6mer
59277-59297
0.001
2
6mer
19359-19383
0.001
3
6mer
7698-7723
0.001
2
6mer
71862-71883
0.001
Not Conserved
6mer
81938-81961
0.001
2
6mer
19960-19980
0.001
2
6mer
37903-37922
0.000
2
CTC-479C5.10
hsa-miR-1287-5p
0.994

Gene Details
Chromosome: 16
Transcript: ENST00000572067
Biotype: lincRNA
Gene id: ENSG00000263126
Gene Name: CTC-479C5.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
85-98
0.038
12
8mer
1209-1228
0.027
13
7mer
573-591
0.014
9
7mer
690-715
0.009
11
6mer
3821-3834
0.003
4
6mer
643-661
0.002
7
6mer
1711-1735
0.001
5
6mer
801-821
0.001
2
6mer
2224-2244
0.001
1
RP1-158P9.1
hsa-miR-1287-5p
0.994

Gene Details
Chromosome: 1
Transcript: ENST00000435828
Biotype: lincRNA
Gene id: ENSG00000235612
Gene Name: RP1-158P9.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
150-175
0.094
9
RP5-1186N24.3
hsa-miR-1287-5p
0.993

Gene Details
Chromosome: 6
Transcript: ENST00000499525
Biotype: antisense
Gene id: ENSG00000246350
Gene Name: RP5-1186N24.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
Fibroblasts Lung Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
529-549
0.078
4
6mer
2572-2598
0.004
2
7mer
809-830
0.004
1
6mer
2151-2172
0.003
1
6mer
1131-1158
0.002
2
6mer
1191-1207
0.001
2
CTD-3049M7.1
hsa-miR-1287-5p
0.993

Gene Details
Chromosome: 15
Transcript: ENST00000556928
Biotype: lincRNA
Gene id: ENSG00000258754
Gene Name: CTD-3049M7.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
11-33
0.091
1
XLOC_001305
hsa-miR-1287-5p
0.992

Gene Details
Chromosome: chr2
Transcript: TCONS_00003529
Biotype: transcript isomorph
Gene id: XLOC_001305
Gene Name: XLOC_001305
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
259-273
0.090
10
RP11-34F13.3
hsa-miR-1287-5p
0.992

Gene Details
Chromosome: 15
Transcript: ENST00000560577
Biotype: retained_intron
Gene id: ENSG00000259410
Gene Name: RP11-34F13.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
142-164
0.085
11
6mer
172-190
0.003
1
6mer
288-310
0.002
2
AC009299.3
hsa-miR-1287-5p
0.992

Gene Details
Chromosome: 2
Transcript: ENST00000436506
Biotype: lincRNA
Gene id: ENSG00000227403
Gene Name: AC009299.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
418-441
0.083
9
6mer
444-467
0.006
8
CTD-3064H18.4
hsa-miR-1287-5p
0.991

Gene Details
Chromosome: 19
Transcript: ENST00000316807
Biotype: antisense
Gene id: ENSG00000180458
Gene Name: CTD-3064H18.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
547-561
0.067
1
7mer
2653-2673
0.012
2
7mer
1771-1791
0.010
2
CTD-2017D11.1
hsa-miR-1287-5p
0.991

Gene Details
Chromosome: 19
Transcript: ENST00000597683
Biotype: lincRNA
Gene id: ENSG00000268362
Gene Name: CTD-2017D11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
931-956
0.080
2
6mer
1539-1565
0.008
2
RP11-34F13.3
hsa-miR-1287-5p
0.991

Gene Details
Chromosome: 15
Transcript: ENST00000558889
Biotype: lincRNA
Gene id: ENSG00000259410
Gene Name: RP11-34F13.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
87-109
0.083
11
6mer
117-135
0.002
1
6mer
233-255
0.002
2
AC009299.3
hsa-miR-1287-5p
0.990

Gene Details
Chromosome: 2
Transcript: ENST00000439050
Biotype: lincRNA
Gene id: ENSG00000227403
Gene Name: AC009299.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
390-413
0.081
9
6mer
416-439
0.005
8
RP11-140I24.1
hsa-miR-1287-5p
0.989

Gene Details
Chromosome: 16
Transcript: ENST00000562661
Biotype: lincRNA
Gene id: ENSG00000258779
Gene Name: RP11-140I24.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
378-403
0.085
5
FGF10-AS1
hsa-miR-1287-5p
0.988

Gene Details
Chromosome: 5
Transcript: ENST00000502457
Biotype: antisense
Gene id: ENSG00000248464
Gene Name: FGF10-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1512-1531
0.079
4
6mer
460-475
0.004
2
RP11-461F11.3
hsa-miR-1287-5p
0.988

Gene Details
Chromosome: 15
Transcript: ENST00000559363
Biotype: lincRNA
Gene id: ENSG00000259582
Gene Name: RP11-461F11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
288-313
0.082
6
XLOC_009180
hsa-miR-1287-5p
0.987

Gene Details
Chromosome: chr11
Transcript: TCONS_00019149
Biotype: transcript isomorph
Gene id: XLOC_009180
Gene Name: XLOC_009180
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
225-249
0.077
3
6mer
2568-2588
0.004
2
RP11-35J10.7
hsa-miR-1287-5p
0.986

Gene Details
Chromosome: 11
Transcript: ENST00000611809
Biotype: sense_intronic
Gene id: ENSG00000276668
Gene Name: RP11-35J10.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
373-399
0.081
2
LL22NC03-86G7.1
hsa-miR-1287-5p
0.986

Gene Details
Chromosome: 22
Transcript: ENST00000458178
Biotype: antisense
Gene id: ENSG00000224086
Gene Name: LL22NC03-86G7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
22706-22725
0.011
9
9mer
10534-10554
0.008
2
6mer
32121-32135
0.004
13
6mer
37695-37720
0.004
2
7mer
26035-26055
0.003
1
6mer
37372-37387
0.003
1
7mer
13754-13778
0.003
1
6mer
669-685
0.003
2
6mer
35261-35287
0.003
7
7mer
33110-33132
0.002
1
6mer
10749-10775
0.002
1
6mer
28798-28815
0.002
2
7mer
17693-17718
0.001
4
6mer
19481-19499
0.001
2
6mer
19788-19810
0.001
3
6mer
34620-34643
0.001
5
6mer
26577-26598
0.001
1
6mer
29375-29400
0.001
2
6mer
13586-13607
0.001
2
6mer
1125-1141
0.001
2
6mer
18618-18636
0.001
2
6mer
17738-17763
0.001
11
6mer
4022-4040
0.001
2
6mer
30094-30112
0.001
2
6mer
29044-29068
0.001
3
6mer
6362-6377
0.001
2
6mer
17209-17230
0.001
4
6mer
34123-34150
0.001
2
6mer
29774-29792
0.001
2
6mer
7420-7447
0.001
1
6mer
35589-35611
0.001
1
6mer
8693-8719
0.001
2
6mer
31725-31742
0.001
1
6mer
27821-27840
0.001
4
6mer
15563-15586
0.001
2
6mer
21296-21323
0.001
1
6mer
30407-30427
0.001
2
6mer
13654-13667
0.001
4
6mer
3803-3828
0.001
2
6mer
33334-33358
0.001
3
6mer
25154-25179
0.001
1
6mer
16595-16611
0.001
2
6mer
23510-23528
0.001
2
6mer
32672-32692
0.001
3
6mer
27730-27757
0.001
1
6mer
5831-5849
0.001
1
6mer
8852-8872
0.001
1
6mer
33410-33428
0.001
2
6mer
17699-17724
0.000
9
6mer
7502-7521
0.000
2
Funded by: