Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
MIR6818
hsa-miR-1287-5p
0.986

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
16616-16626
0.007
4
7mer
34437-34450
0.007
9
7mer
33587-33608
0.007
7
7mer
1658-1676
0.006
1
8mer
21814-21832
0.005
1
7mer
30920-30947
0.004
5
7mer
32459-32478
0.003
1
7mer
27654-27673
0.003
2
7mer
1804-1826
0.003
1
7mer
4608-4634
0.002
4
6mer
24284-24305
0.002
2
6mer
42076-42102
0.002
6
6mer
29656-29682
0.002
3
7mer
43612-43627
0.002
5
6mer
42484-42502
0.002
2
6mer
5135-5156
0.001
2
6mer
47339-47358
0.001
5
6mer
20787-20807
0.001
1
6mer
20504-20516
0.001
2
6mer
48006-48027
0.001
4
6mer
6790-6814
0.001
Not Conserved
6mer
46639-46664
0.001
2
6mer
31994-32017
0.001
3
6mer
4413-4433
0.001
2
6mer
5974-5999
0.001
4
6mer
35606-35627
0.001
1
6mer
17824-17842
0.001
2
6mer
7266-7291
0.001
3
6mer
25331-25346
0.001
2
6mer
4735-4753
0.001
2
6mer
13178-13196
0.001
2
6mer
11678-11696
0.001
2
6mer
36144-36163
0.001
1
6mer
10326-10344
0.001
1
6mer
43537-43561
0.001
5
6mer
47329-47344
0.000
3
6mer
27647-27673
0.000
2
XLOC_001621
hsa-miR-1287-5p
0.984

Gene Details
Chromosome: chr2
Transcript: TCONS_00003817
Biotype: transcript isomorph
Gene id: XLOC_001621
Gene Name: XLOC_001621
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1988-2007
0.043
2
6mer
214-239
0.014
2
6mer
2074-2092
0.013
2
6mer
1489-1508
0.008
2
LINC00649
hsa-miR-1287-5p
0.982

Gene Details
Chromosome: 21
Transcript: ENST00000595747
Biotype: antisense
Gene id: ENSG00000237945
Gene Name: LINC00649
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
57-77
0.072
2
6mer
360-380
0.004
2
AC006277.2
hsa-miR-1287-5p
0.982

Gene Details
Chromosome: 19
Transcript: ENST00000520090
Biotype: antisense
Gene id: ENSG00000253392
Gene Name: AC006277.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
433-450
0.035
3
7mer
472-496
0.024
7
7mer
583-610
0.017
1
RP11-140I24.1
hsa-miR-1287-5p
0.981

Gene Details
Chromosome: 16
Transcript: ENST00000555721
Biotype: lincRNA
Gene id: ENSG00000258779
Gene Name: RP11-140I24.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
764-789
0.075
5
RP11-50D16.4
hsa-miR-1287-5p
0.981

Gene Details
Chromosome: 13
Transcript: ENST00000614005
Biotype: lincRNA
Gene id: ENSG00000273507
Gene Name: RP11-50D16.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
591-610
0.071
2
6mer
473-492
0.005
1
XLOC_000008
hsa-miR-1287-5p
0.981

Gene Details
Chromosome: chr1
Transcript: TCONS_00001909
Biotype: transcript isomorph
Gene id: XLOC_000008
Gene Name: XLOC_000008
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1157-1174
0.009
1
7mer
1042-1063
0.008
1
7mer
1122-1139
0.008
1
7mer
525-542
0.006
1
7mer
1287-1314
0.005
Not Conserved
7mer
175-192
0.005
Not Conserved
7mer
350-367
0.005
Not Conserved
7mer
245-262
0.004
Not Conserved
6mer
1332-1349
0.003
1
7mer
633-647
0.003
Not Conserved
7mer
805-822
0.003
Not Conserved
7mer
595-612
0.003
Not Conserved
7mer
420-437
0.003
Not Conserved
6mer
1402-1419
0.002
Not Conserved
6mer
105-122
0.002
Not Conserved
6mer
840-856
0.002
1
6mer
210-227
0.001
Not Conserved
6mer
977-996
0.001
Not Conserved
6mer
770-787
0.001
Not Conserved
6mer
560-577
0.001
Not Conserved
6mer
655-682
0.001
Not Conserved
LINC00884
hsa-miR-1287-5p
0.980

Gene Details
Chromosome: 3
Transcript: ENST00000448892
Biotype: antisense
Gene id: ENSG00000233058
Gene Name: LINC00884
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2467-2491
0.070
1
6mer
1995-2016
0.004
3
OCIAD1-AS1
hsa-miR-1287-5p
0.980

Gene Details
Chromosome: 4
Transcript: ENST00000513576
Biotype: antisense
Gene id: ENSG00000248256
Gene Name: OCIAD1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
46-67
0.074
6
CSMD2-AS1
hsa-miR-1287-5p
0.979

Gene Details
Chromosome: 1
Transcript: ENST00000438719
Biotype: antisense
Gene id: ENSG00000231163
Gene Name: CSMD2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
514-533
0.073
2
MIR4534
hsa-miR-1287-5p
0.978

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
16537-16560
0.005
2
8mer
16149-16167
0.005
2
7mer
29430-29455
0.004
3
7mer
32256-32270
0.003
2
6mer
52-70
0.003
2
7mer
15704-15720
0.003
1
7mer
38474-38496
0.003
5
6mer
53887-53908
0.003
1
7mer
1431-1456
0.002
Not Conserved
7mer
22576-22595
0.002
2
6mer
223-241
0.002
2
7mer
13035-13052
0.002
Not Conserved
6mer
34583-34604
0.002
3
6mer
22884-22908
0.001
6
6mer
40987-41005
0.001
2
6mer
31335-31351
0.001
4
6mer
35605-35622
0.001
2
6mer
51895-51911
0.001
3
6mer
3761-3782
0.001
2
6mer
24916-24934
0.001
2
6mer
22209-22227
0.001
2
6mer
43953-43972
0.001
2
6mer
49059-49078
0.001
1
6mer
32812-32838
0.001
2
6mer
47853-47872
0.001
5
6mer
49384-49399
0.001
4
6mer
19856-19875
0.001
7
6mer
31737-31754
0.001
2
6mer
16312-16333
0.001
1
6mer
49273-49293
0.001
2
6mer
5686-5709
0.001
2
6mer
34860-34883
0.001
2
6mer
36783-36809
0.001
3
6mer
34222-34246
0.001
3
6mer
39932-39950
0.001
1
6mer
21889-21914
0.001
2
6mer
49631-49649
0.001
2
6mer
41929-41947
0.001
1
7mer
42012-42030
0.001
Not Conserved
6mer
2501-2526
0.001
1
6mer
40031-40052
0.001
2
6mer
2814-2832
0.001
1
6mer
45591-45609
0.001
Not Conserved
6mer
42135-42156
0.001
2
6mer
31913-31933
0.001
2
6mer
32309-32321
0.000
1
6mer
32010-32037
0.000
1
6mer
13061-13071
0.000
1
6mer
38569-38591
0.000
2
CSMD2-AS1
hsa-miR-1287-5p
0.977

Gene Details
Chromosome: 1
Transcript: ENST00000432447
Biotype: antisense
Gene id: ENSG00000231163
Gene Name: CSMD2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
395-414
0.072
2
RP11-69H7.2
hsa-miR-1287-5p
0.977

Gene Details
Chromosome: 15
Transcript: ENST00000563803
Biotype: lincRNA
Gene id: ENSG00000260660
Gene Name: RP11-69H7.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
245-261
0.072
7
RP11-622A1.2
hsa-miR-1287-5p
0.977

Gene Details
Chromosome: 4
Transcript: ENST00000504368
Biotype: lincRNA
Gene id: ENSG00000250436
Gene Name: RP11-622A1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
166-181
0.072
7
RP11-104J23.1
hsa-miR-1287-5p
0.976

Gene Details
Chromosome: 17
Transcript: ENST00000617328
Biotype: antisense
Gene id: ENSG00000275944
Gene Name: RP11-104J23.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
297-312
0.048
1
6mer
39-54
0.008
1
6mer
491-504
0.004
1
6mer
509-525
0.003
1
RNF144A-AS1
hsa-miR-1287-5p
0.975

Gene Details
Chromosome: 2
Transcript: ENST00000418970
Biotype: antisense
Gene id: ENSG00000228203
Gene Name: RNF144A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
49-70
0.061
2
7mer
607-627
0.005
2
6mer
507-531
0.003
2
6mer
675-691
0.002
2
RNF144A-AS1
hsa-miR-1287-5p
0.975

Gene Details
Chromosome: 2
Transcript: NR_033997.1
Biotype: antisense
Gene id: NR_033997.1 (gene)
Gene Name: RNF144A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
50-71
0.061
2
7mer
608-628
0.005
2
6mer
508-532
0.003
2
6mer
676-692
0.002
2
RP11-716H6.2
hsa-miR-1287-5p
0.975

Gene Details
Chromosome: 11
Transcript: ENST00000526777
Biotype: antisense
Gene id: ENSG00000255219
Gene Name: RP11-716H6.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
389-407
0.043
10
7mer
495-514
0.027
5
RP5-1024G6.7
hsa-miR-1287-5p
0.973

Gene Details
Chromosome: 1
Transcript: ENST00000569869
Biotype: antisense
Gene id: ENSG00000259818
Gene Name: RP5-1024G6.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3525-3543
0.067
1
7mer
2308-2331
0.003
2
CSMD2-AS1
hsa-miR-1287-5p
0.973

Gene Details
Chromosome: 1
Transcript: ENST00000434181
Biotype: antisense
Gene id: ENSG00000231163
Gene Name: CSMD2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
491-510
0.069
2
Funded by: