Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC093627.7
hsa-miR-1287-5p
0.926

Gene Details
Chromosome: 7
Transcript: ENST00000465755
Biotype: lincRNA
Gene id: ENSG00000232325
Gene Name: AC093627.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
118-144
0.017
2
6mer
139-158
0.016
2
6mer
17-34
0.013
2
6mer
113-139
0.006
1
RP4-734G22.3
hsa-miR-1287-5p
0.925

Gene Details
Chromosome: 1
Transcript: ENST00000606802
Biotype: antisense
Gene id: ENSG00000272078
Gene Name: RP4-734G22.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
667-692
0.018
13
7mer
694-710
0.010
11
7mer
492-518
0.009
9
7mer
5670-5693
0.003
2
6mer
7493-7520
0.003
9
6mer
4206-4225
0.002
8
6mer
7090-7116
0.001
3
6mer
2327-2341
0.001
3
6mer
5252-5277
0.001
4
6mer
5969-5994
0.001
4
6mer
2625-2648
0.001
1
7mer
5302-5317
0.001
Not Conserved
6mer
2840-2862
0.001
2
6mer
4415-4434
0.001
1
6mer
4457-4480
0.000
3
XLOC_000036
hsa-miR-1287-5p
0.924

Gene Details
Chromosome: chr1
Transcript: TCONS_00001929
Biotype: transcript isomorph
Gene id: XLOC_000036
Gene Name: XLOC_000036
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
243-262
0.052
2
ZNF213-AS1
hsa-miR-1287-5p
0.924

Gene Details
Chromosome: 16
Transcript: ENST00000573447
Biotype: antisense
Gene id: ENSG00000263072
Gene Name: ZNF213-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
550-569
0.028
2
8mer
879-895
0.018
1
6mer
759-785
0.005
2
RP11-1252I4.2
hsa-miR-1287-5p
0.923

Gene Details
Chromosome: 5
Transcript: ENST00000511650
Biotype: lincRNA
Gene id: ENSG00000250101
Gene Name: RP11-1252I4.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
280-295
0.036
2
6mer
304-327
0.015
2
RP11-725M22.1
hsa-miR-1287-5p
0.923

Gene Details
Chromosome: 4
Transcript: ENST00000513564
Biotype: lincRNA
Gene id: ENSG00000250597
Gene Name: RP11-725M22.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-47
0.051
1
XLOC_010682
hsa-miR-1287-5p
0.923

Gene Details
Chromosome: chr13
Transcript: TCONS_00021677
Biotype: transcript isomorph
Gene id: XLOC_010682
Gene Name: XLOC_010682
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
181-200
0.051
2
XLOC_013360
hsa-miR-1287-5p
0.923

Gene Details
Chromosome: chr19
Transcript: TCONS_00027378
Biotype: transcript isomorph
Gene id: XLOC_013360
Gene Name: XLOC_013360
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
64-88
0.051
3
AC017002.4
hsa-miR-1287-5p
0.922

Gene Details
Chromosome: 2
Transcript: ENST00000426124
Biotype: lincRNA
Gene id: ENSG00000225744
Gene Name: AC017002.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
192-214
0.032
2
6mer
109-122
0.011
3
6mer
3-28
0.009
3
AC090044.2
hsa-miR-1287-5p
0.922

Gene Details
Chromosome: 3
Transcript: ENST00000423193
Biotype: lincRNA
Gene id: ENSG00000224239
Gene Name: AC090044.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
183-203
0.013
2
6mer
447-466
0.012
2
6mer
231-255
0.012
2
6mer
288-307
0.009
2
6mer
398-416
0.006
1
RP11-1007G5.2
hsa-miR-1287-5p
0.922

Gene Details
Chromosome: 11
Transcript: ENST00000525706
Biotype: antisense
Gene id: ENSG00000254588
Gene Name: RP11-1007G5.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
980-1005
0.035
2
7mer
501-516
0.009
1
6mer
201-227
0.004
1
6mer
295-312
0.003
2
LL22NC03-22D1.1
hsa-miR-1287-5p
0.921

Gene Details
Chromosome: 22
Transcript: ENST00000624601
Biotype: lincRNA
Gene id: ENSG00000279003
Gene Name: LL22NC03-22D1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
21348-21365
0.010
1
9mer
9470-9486
0.010
1
7mer
12927-12948
0.005
3
6mer
28953-28970
0.004
1
7mer
25314-25336
0.004
2
7mer
19620-19632
0.003
2
7mer
7873-7896
0.003
2
7mer
26538-26558
0.002
1
6mer
3872-3893
0.001
2
6mer
9841-9865
0.001
2
6mer
25450-25473
0.001
2
6mer
2627-2638
0.001
Not Conserved
6mer
26482-26500
0.001
3
6mer
20440-20465
0.001
2
6mer
4085-4103
0.001
1
6mer
25524-25551
0.001
2
6mer
26631-26655
0.000
1
LINC00112
hsa-miR-1287-5p
0.921

Gene Details
Chromosome: 21
Transcript: ENST00000432830
Biotype: antisense
Gene id: ENSG00000232401
Gene Name: LINC00112
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
28-44
0.024
2
7mer
444-459
0.022
1
6mer
419-441
0.005
1
XLOC_007257
hsa-miR-1287-5p
0.920

Gene Details
Chromosome: chr8
Transcript: TCONS_00015198
Biotype: transcript isomorph
Gene id: XLOC_007257
Gene Name: XLOC_007257
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
67-88
0.051
2
LINC00680
hsa-miR-1287-5p
0.920

Gene Details
Chromosome: 6
Transcript: ENST00000422882
Biotype: lincRNA
Gene id: ENSG00000215190
Gene Name: LINC00680
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2207-2229
0.012
1
6mer
295-311
0.011
1
6mer
314-329
0.010
1
8mer+mismatch
2145-2168
0.009
1
6mer
1827-1845
0.008
1
RP11-1102P16.1
hsa-miR-1287-5p
0.919

Gene Details
Chromosome: 8
Transcript: ENST00000523327
Biotype: lincRNA
Gene id: ENSG00000253379
Gene Name: RP11-1102P16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
138-163
0.050
8
XLOC_013708
hsa-miR-1287-5p
0.917

Gene Details
Chromosome: chr20
Transcript: TCONS_00028355
Biotype: transcript isomorph
Gene id: XLOC_013708
Gene Name: XLOC_013708
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
210-233
0.050
1
CTC-327F10.5
hsa-miR-1287-5p
0.917

Gene Details
Chromosome: 5
Transcript: ENST00000512300
Biotype: antisense
Gene id: ENSG00000248362
Gene Name: CTC-327F10.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
262-276
0.050
3
XLOC_012139
hsa-miR-1287-5p
0.916

Gene Details
Chromosome: chr17
Transcript: TCONS_00025161
Biotype: transcript isomorph
Gene id: XLOC_012139
Gene Name: XLOC_012139
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
536-562
0.050
2
XLOC_013274
hsa-miR-1287-5p
0.915

Gene Details
Chromosome: chr19
Transcript: TCONS_00027238
Biotype: transcript isomorph
Gene id: XLOC_013274
Gene Name: XLOC_013274
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2128-2146
0.009
1
6mer
602-622
0.007
2
6mer
770-788
0.007
2
6mer
1473-1492
0.006
2
6mer
5850-5875
0.005
2
6mer
5631-5656
0.005
2
6mer
4767-4780
0.003
2
6mer
983-1005
0.003
1
6mer
2908-2935
0.003
2
6mer
2314-2340
0.002
1
6mer
3053-3074
0.001
Not Conserved
Funded by: