Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LOC100128593
hsa-miR-1287-5p
0.915

Gene Details
Chromosome: 9
Transcript: NR_033913.1
Biotype: antisense
Gene id: NR_033913.1 (gene)
Gene Name: LOC100128593
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2655-2673
0.003
1
6mer
551-568
0.002
2
7mer
640-653
0.002
Not Conserved
6mer
796-818
0.002
2
6mer
1821-1848
0.002
2
6mer
668-690
0.002
2
6mer
603-625
0.002
1
7mer
722-735
0.001
Not Conserved
7mer
1165-1181
0.001
1
6mer
661-683
0.001
1
6mer
592-610
0.001
Not Conserved
6mer
773-788
0.001
1
6mer
575-597
0.001
Not Conserved
6mer
552-575
0.001
1
6mer
693-713
0.001
1
6mer
656-668
0.001
Not Conserved
6mer
750-773
0.001
1
6mer
563-582
0.001
Not Conserved
6mer
864-879
0.001
2
6mer
953-969
0.001
2
6mer
640-661
0.001
Not Conserved
6mer
1409-1433
0.001
2
6mer
939-961
0.001
1
6mer
894-909
0.001
1
6mer
969-992
0.001
1
6mer
904-924
0.001
1
6mer
722-743
0.001
Not Conserved
6mer
848-864
0.001
Not Conserved
6mer
683-698
0.001
1
6mer
813-826
0.001
Not Conserved
6mer
1116-1142
0.001
1
6mer
1045-1067
0.001
1
6mer
848-871
0.001
1
6mer
935-953
0.001
Not Conserved
6mer
1030-1052
0.001
1
6mer
987-1007
0.001
1
6mer
1007-1030
0.001
Not Conserved
6mer
813-833
0.001
Not Conserved
6mer
882-901
0.001
Not Conserved
6mer
1075-1090
0.001
1
6mer
1135-1157
0.001
Not Conserved
6mer
1025-1037
0.001
1
6mer
1152-1165
0.001
1
6mer
1100-1120
0.001
1
6mer
987-999
0.001
Not Conserved
6mer
1062-1082
0.000
Not Conserved
6mer
1025-1043
0.000
Not Conserved
CTD-3105H18.13
hsa-miR-1287-5p
0.914

Gene Details
Chromosome: 19
Transcript: ENST00000563695
Biotype: lincRNA
Gene id: ENSG00000261280
Gene Name: CTD-3105H18.13
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
535-562
0.037
2
6mer
1829-1848
0.012
2
CARS-AS1
hsa-miR-1287-5p
0.914

Gene Details
Chromosome: 11
Transcript: ENST00000499962
Biotype: antisense
Gene id: ENSG00000247473
Gene Name: CARS-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
30-45
0.027
9
8mer
58-77
0.018
1
7mer
1716-1739
0.003
1
6mer
1379-1394
0.002
2
MCF2L-AS1
hsa-miR-1287-5p
0.914

Gene Details
Chromosome: 13
Transcript: NR_034002.1
Biotype: antisense
Gene id: NR_034002.1 (gene)
Gene Name: MCF2L-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
287-307
0.008
2
7mer
608-629
0.008
1
7mer
347-368
0.006
1
7mer
467-482
0.005
1
6mer
915-936
0.003
1
6mer
258-274
0.002
1
6mer
326-343
0.002
1
6mer
266-283
0.002
1
6mer
506-521
0.002
2
6mer
438-454
0.002
1
6mer
318-334
0.002
Not Conserved
6mer
386-406
0.002
1
6mer
446-463
0.002
1
6mer
498-517
0.002
1
LINC00475
hsa-miR-1287-5p
0.914

Gene Details
Chromosome: 9
Transcript: ENST00000444476
Biotype: lincRNA
Gene id: ENSG00000225511
Gene Name: LINC00475
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
182-201
0.049
1
XLOC_000266
hsa-miR-1287-5p
0.914

Gene Details
Chromosome: chr1
Transcript: TCONS_00001003
Biotype: transcript isomorph
Gene id: XLOC_000266
Gene Name: XLOC_000266
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1022-1048
0.043
2
6mer
738-755
0.003
2
6mer
459-482
0.003
2
RP11-420K14.8
hsa-miR-1287-5p
0.914

Gene Details
Chromosome: 19
Transcript: ENST00000593824
Biotype: lincRNA
Gene id: ENSG00000268184
Gene Name: RP11-420K14.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
206-226
0.049
1
CTC-510F12.2
hsa-miR-1287-5p
0.913

Gene Details
Chromosome: 19
Transcript: ENST00000588634
Biotype: antisense
Gene id: ENSG00000267082
Gene Name: CTC-510F12.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
364-387
0.047
1
6mer
401-427
0.003
1
AC003973.5
hsa-miR-1287-5p
0.913

Gene Details
Chromosome: 19
Transcript: ENST00000600071
Biotype: lincRNA
Gene id: ENSG00000269199
Gene Name: AC003973.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
104-129
0.049
2
CASC15
hsa-miR-1287-5p
0.913

Gene Details
Chromosome: 6
Transcript: ENST00000444265
Biotype: lincRNA
Gene id: ENSG00000272168
Gene Name: CASC15
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
542-562
0.030
2
7mer
164-182
0.013
4
6mer
1410-1429
0.003
1
6mer
1100-1126
0.003
1
CTB-180C19.1
hsa-miR-1287-5p
0.912

Gene Details
Chromosome: 5
Transcript: ENST00000521697
Biotype: antisense
Gene id: ENSG00000254365
Gene Name: CTB-180C19.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
490-514
0.049
3
XLOC_013552
hsa-miR-1287-5p
0.911

Gene Details
Chromosome: chr20
Transcript: TCONS_00028202
Biotype: transcript isomorph
Gene id: XLOC_013552
Gene Name: XLOC_013552
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
175-194
0.004
2
6mer
445-464
0.003
2
6mer
280-304
0.002
1
6mer
234-253
0.002
2
6mer
706-723
0.002
1
7mer
2147-2167
0.002
Not Conserved
7mer
2545-2566
0.002
Not Conserved
7mer
4183-4203
0.001
1
6mer
4448-4468
0.001
1
6mer
3469-3489
0.001
1
6mer
1075-1093
0.001
1
7mer
1811-1837
0.001
1
6mer
810-829
0.001
1
6mer
1630-1655
0.001
2
6mer
757-776
0.001
1
6mer
4032-4052
0.001
1
6mer
863-882
0.001
1
6mer
4897-4920
0.001
Not Conserved
6mer
2934-2958
0.001
Not Conserved
6mer
1221-1246
0.001
Not Conserved
6mer
969-988
0.001
1
6mer
912-935
0.001
1
6mer
3717-3736
0.001
1
6mer
1439-1457
0.001
2
6mer
3522-3542
0.001
2
6mer
1281-1299
0.001
2
6mer
5217-5234
0.001
2
6mer
2309-2329
0.001
Not Conserved
6mer
3564-3583
0.001
1
6mer
1791-1810
0.001
1
6mer
1333-1352
0.001
2
6mer
1690-1708
0.001
2
6mer
3097-3115
0.001
Not Conserved
6mer
2409-2433
0.001
Not Conserved
6mer
1491-1510
0.001
2
6mer
4954-4973
0.001
1
6mer
3206-3226
0.000
Not Conserved
6mer
2468-2486
0.000
Not Conserved
6mer
2730-2749
0.000
Not Conserved
6mer
4555-4574
0.000
1
6mer
2624-2643
0.000
Not Conserved
6mer
4086-4104
0.000
1
6mer
3823-3842
0.000
1
6mer
3613-3636
0.000
1
6mer
5011-5026
0.000
1
6mer
4612-4627
0.000
Not Conserved
6mer
3769-3789
0.000
1
6mer
3660-3683
0.000
1
6mer
5108-5131
0.000
1
6mer
5058-5078
0.000
1
6mer
4498-4521
0.000
1
6mer
2676-2696
0.000
Not Conserved
6mer
2992-3010
0.000
Not Conserved
6mer
4660-4680
0.000
Not Conserved
6mer
2201-2220
0.000
Not Conserved
XLOC_010996
hsa-miR-1287-5p
0.910

Gene Details
Chromosome: chr14
Transcript: TCONS_00023093
Biotype: transcript isomorph
Gene id: XLOC_010996
Gene Name: XLOC_010996
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
6841-6865
0.040
2
7mer
4746-4773
0.003
1
7mer
3744-3762
0.003
2
6mer
5465-5490
0.001
2
6mer
2906-2929
0.001
2
RP11-342C20.2
hsa-miR-1287-5p
0.909

Gene Details
Chromosome: 13
Transcript: ENST00000607309
Biotype: lincRNA
Gene id: ENSG00000232636
Gene Name: RP11-342C20.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
195-214
0.048
2
RP11-171I2.1
hsa-miR-1287-5p
0.909

Gene Details
Chromosome: 2
Transcript: ENST00000590024
Biotype: antisense
Gene id: ENSG00000267784
Gene Name: RP11-171I2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
575-600
0.026
8
7mer
2693-2711
0.008
2
7mer
1852-1873
0.007
3
7mer
1961-1984
0.007
7
CTD-2118P12.1
hsa-miR-1287-5p
0.908

Gene Details
Chromosome: 5
Transcript: ENST00000565798
Biotype: lincRNA
Gene id: ENSG00000259786
Gene Name: CTD-2118P12.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
297-318
0.046
5
6mer
823-841
0.002
1
LINC00638
hsa-miR-1287-5p
0.908

Gene Details
Chromosome: 14
Transcript: ENST00000555578
Biotype: lincRNA
Gene id: ENSG00000258701
Gene Name: LINC00638
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2030-2047
0.033
2
6mer
447-473
0.008
2
6mer
2467-2489
0.002
Not Conserved
6mer
1109-1133
0.002
1
6mer
360-387
0.002
Not Conserved
RP11-158I13.2
hsa-miR-1287-5p
0.907

Gene Details
Chromosome: 2
Transcript: ENST00000505973
Biotype: processed_transcript
Gene id: ENSG00000259080
Gene Name: RP11-158I13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
191-214
0.031
4
9mer
1435-1450
0.012
1
6mer
651-675
0.005
10
CASC15
hsa-miR-1287-5p
0.906

Gene Details
Chromosome: 6
Transcript: ENST00000607048
Biotype: lincRNA
Gene id: ENSG00000272168
Gene Name: CASC15
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
719-739
0.028
2
7mer
341-359
0.011
4
6mer
93-117
0.006
6
6mer
1242-1268
0.003
1
XLOC_000191
hsa-miR-1287-5p
0.903

Gene Details
Chromosome: chr1
Transcript: TCONS_00000939
Biotype: transcript isomorph
Gene id: XLOC_000191
Gene Name: XLOC_000191
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
918-944
0.031
2
6mer
1619-1643
0.011
2
6mer
2028-2046
0.005
1
Funded by: