Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

TCONS_00015261
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_006753
hsa-miR-1287-5p
0.899

Gene Details
Chromosome: chr8
Transcript: TCONS_00015261
Biotype: transcript isomorph
Gene id: XLOC_006753
Gene Name: XLOC_006753
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4708-4732
0.028
3
8mer
2373-2396
0.010
1
6mer
6313-6337
0.003
5
6mer
4132-4153
0.002
2
6mer
2132-2153
0.002
2
6mer
4451-4476
0.001
2
6mer
1448-1474
0.001
1
6mer
4268-4287
0.001
2
Funded by: