Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP5-1114G22.2
hsa-miR-1287-5p
0.889

Gene Details
Chromosome: 1
Transcript: ENST00000412357
Biotype: lincRNA
Gene id: ENSG00000230687
Gene Name: RP5-1114G22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
518-538
0.020
5
7mer
430-455
0.012
3
7mer
563-589
0.010
3
6mer
469-494
0.003
5
RP11-320P7.2
hsa-miR-1287-5p
0.889

Gene Details
Chromosome: 12
Transcript: ENST00000552324
Biotype: lincRNA
Gene id: ENSG00000257139
Gene Name: RP11-320P7.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
58-82
0.039
1
6mer
140-157
0.004
2
6mer
530-546
0.001
Not Conserved
RP11-7F17.3
hsa-miR-1287-5p
0.888

Gene Details
Chromosome: 14
Transcript: ENST00000556781
Biotype: lincRNA
Gene id: ENSG00000258819
Gene Name: RP11-7F17.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
784-805
0.045
2
RP11-168O16.1
hsa-miR-1287-5p
0.888

Gene Details
Chromosome: 1
Transcript: ENST00000458003
Biotype: antisense
Gene id: ENSG00000229191
Gene Name: RP11-168O16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
134-161
0.027
2
6mer
775-799
0.004
4
8mer
2729-2748
0.004
Not Conserved
6mer
1540-1559
0.002
7
6mer
632-650
0.002
2
6mer
1973-1998
0.002
2
6mer
1483-1500
0.002
4
6mer
860-875
0.001
2
6mer
1585-1607
0.001
3
RP13-16H11.2
hsa-miR-1287-5p
0.888

Gene Details
Chromosome: 10
Transcript: ENST00000446557
Biotype: lincRNA
Gene id: ENSG00000227932
Gene Name: RP13-16H11.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
172-193
0.045
7
RP11-104J23.2
hsa-miR-1287-5p
0.888

Gene Details
Chromosome: 17
Transcript: ENST00000617747
Biotype: lincRNA
Gene id: ENSG00000278690
Gene Name: RP11-104J23.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
309-329
0.045
2
SHANK3
hsa-miR-1287-5p
0.888

Gene Details
Chromosome: 22
Transcript: ENST00000445220
Biotype: processed_transcript
Gene id: ENSG00000251322
Gene Name: SHANK3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
4804-4817
0.009
13
7mer
4106-4122
0.008
8
7mer
4941-4963
0.006
5
6mer
359-372
0.004
9
6mer
150-171
0.004
7
6mer
2013-2037
0.003
11
6mer
2524-2540
0.002
10
6mer
3608-3627
0.002
8
6mer
4294-4315
0.002
8
6mer
3983-4005
0.001
5
6mer
3837-3858
0.001
3
6mer
4056-4077
0.001
4
6mer
1144-1157
0.001
2
6mer
1184-1210
0.001
5
6mer
3630-3645
0.000
4
RP13-188A5.1
hsa-miR-1287-5p
0.888

Gene Details
Chromosome: X
Transcript: ENST00000452532
Biotype: lincRNA
Gene id: ENSG00000227486
Gene Name: RP13-188A5.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
141-160
0.045
2
PCAT19
hsa-miR-1287-5p
0.888

Gene Details
Chromosome: 19
Transcript: ENST00000595837
Biotype: lincRNA
Gene id: ENSG00000267107
Gene Name: PCAT19
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
865-890
0.024
1
7mer
143-160
0.021
1
AC007392.4
hsa-miR-1287-5p
0.888

Gene Details
Chromosome: 2
Transcript: ENST00000433432
Biotype: lincRNA
Gene id: ENSG00000237179
Gene Name: AC007392.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Colon Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
216-241
0.044
12
RP4-568C11.4
hsa-miR-1287-5p
0.887

Gene Details
Chromosome: 20
Transcript: ENST00000620459
Biotype: lincRNA
Gene id: ENSG00000274173
Gene Name: RP4-568C11.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
706-727
0.036
1
6mer
556-572
0.008
1
XLOC_003730
hsa-miR-1287-5p
0.887

Gene Details
Chromosome: chr4
Transcript: TCONS_00008287
Biotype: transcript isomorph
Gene id: XLOC_003730
Gene Name: XLOC_003730
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
804-822
0.024
2
8mer
9-31
0.020
1
RP4-798P15.3
hsa-miR-1287-5p
0.886

Gene Details
Chromosome: 1
Transcript: ENST00000466953
Biotype: retained_intron
Gene id: ENSG00000254154
Gene Name: RP4-798P15.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2829-2855
0.009
9
7mer
5331-5356
0.009
9
7mer
6098-6120
0.008
2
6mer
6112-6128
0.006
8
7mer
5305-5329
0.004
7
6mer
5511-5538
0.002
2
6mer
3215-3233
0.001
9
6mer
2742-2766
0.001
12
6mer
2781-2797
0.001
10
6mer
3342-3362
0.001
2
6mer
1947-1971
0.001
1
7mer
1287-1307
0.001
1
6mer
1917-1933
0.000
3
6mer
1900-1917
0.000
3
MEIS1-AS2
hsa-miR-1287-5p
0.884

Gene Details
Chromosome: 2
Transcript: ENST00000439433
Biotype: antisense
Gene id: ENSG00000230749
Gene Name: MEIS1-AS2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
457-481
0.044
11
LINC01121
hsa-miR-1287-5p
0.884

Gene Details
Chromosome: 2
Transcript: ENST00000378479
Biotype: lincRNA
Gene id: ENSG00000205054
Gene Name: LINC01121
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
318-336
0.021
8
7mer
758-780
0.016
6
6mer
594-608
0.004
5
6mer
996-1018
0.003
4
C1QTNF3-AMACR
hsa-miR-1287-5p
0.884

Gene Details
Chromosome: 5
Transcript: NR_037951.1
Biotype: sense
Gene id: NR_037951.1 (gene)
Gene Name: C1QTNF3-AMACR
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2971-2991
0.037
7
6mer
291-317
0.004
2
6mer
2829-2853
0.003
7
6mer
1303-1321
0.001
1
RP11-584P21.2
hsa-miR-1287-5p
0.882

Gene Details
Chromosome: 4
Transcript: ENST00000502400
Biotype: lincRNA
Gene id: ENSG00000250075
Gene Name: RP11-584P21.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
792-811
0.022
Not Conserved
7mer
1796-1814
0.021
2
LINC00538
hsa-miR-1287-5p
0.882

Gene Details
Chromosome: 1
Transcript: NR_046189.1
Biotype: lincRNA
Gene id: NR_046189.1 (gene)
Gene Name: LINC00538
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
397-412
0.030
3
6mer
1040-1066
0.006
8
6mer
44-61
0.005
2
6mer
803-827
0.003
3
RP1-225E12.2
hsa-miR-1287-5p
0.882

Gene Details
Chromosome: 6
Transcript: ENST00000591102
Biotype: antisense
Gene id: ENSG00000231329
Gene Name: RP1-225E12.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
323-345
0.040
2
6mer
661-685
0.003
2
RP3-335N17.2
hsa-miR-1287-5p
0.882

Gene Details
Chromosome: 6
Transcript: ENST00000589278
Biotype: antisense
Gene id: ENSG00000228689
Gene Name: RP3-335N17.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
338-357
0.044
2
Funded by: