Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-95M5.1
hsa-miR-1287-5p
0.880

Gene Details
Chromosome: 3
Transcript: ENST00000566553
Biotype: lincRNA
Gene id: ENSG00000260902
Gene Name: RP11-95M5.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
295-315
0.035
3
7mer
3716-3733
0.007
2
7mer
2569-2589
0.001
2
6mer
2476-2486
0.000
1
RP11-756P10.4
hsa-miR-1287-5p
0.879

Gene Details
Chromosome: 4
Transcript: ENST00000505178
Biotype: lincRNA
Gene id: ENSG00000249269
Gene Name: RP11-756P10.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
92-111
0.026
2
7mer
347-370
0.014
1
6mer
227-252
0.002
Not Conserved
MCF2L-AS1
hsa-miR-1287-5p
0.878

Gene Details
Chromosome: 13
Transcript: ENST00000446789
Biotype: antisense
Gene id: ENSG00000235280
Gene Name: MCF2L-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
287-307
0.008
2
7mer
467-482
0.008
1
7mer
347-368
0.006
1
6mer
446-463
0.003
1
6mer
438-454
0.003
1
6mer
506-523
0.002
2
6mer
498-523
0.002
1
6mer
258-274
0.002
1
6mer
326-343
0.002
1
6mer
266-283
0.002
1
6mer
386-406
0.002
1
6mer
318-334
0.002
Not Conserved
RP11-586K12.10
hsa-miR-1287-5p
0.878

Gene Details
Chromosome: 16
Transcript: ENST00000570183
Biotype: lincRNA
Gene id: ENSG00000260311
Gene Name: RP11-586K12.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
951-965
0.014
1
6mer
1771-1787
0.009
1
6mer
537-556
0.008
1
6mer
1454-1474
0.006
1
6mer
1771-1795
0.006
1
RP11-481J2.2
hsa-miR-1287-5p
0.877

Gene Details
Chromosome: 16
Transcript: ENST00000562322
Biotype: lincRNA
Gene id: ENSG00000260186
Gene Name: RP11-481J2.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
509-535
0.035
1
6mer
448-465
0.006
1
6mer
495-519
0.002
Not Conserved
XLOC_000235
hsa-miR-1287-5p
0.877

Gene Details
Chromosome: chr1
Transcript: TCONS_00000970
Biotype: transcript isomorph
Gene id: XLOC_000235
Gene Name: XLOC_000235
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
213-234
0.030
2
6mer
47-63
0.013
2
RP11-536C10.4
hsa-miR-1287-5p
0.877

Gene Details
Chromosome: 14
Transcript: ENST00000552261
Biotype: antisense
Gene id: ENSG00000257959
Gene Name: RP11-536C10.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
70-95
0.043
Not Conserved
TSIX
hsa-miR-1287-5p
0.876

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
23007-23025
0.007
3
7mer
7953-7971
0.004
1
7mer
26815-26833
0.003
1
6mer
28898-28920
0.003
9
7mer
21469-21484
0.003
1
7mer
1969-1987
0.002
Not Conserved
6mer
10181-10193
0.002
1
6mer
24191-24206
0.002
3
6mer
18513-18532
0.002
Not Conserved
6mer
24558-24578
0.001
2
6mer
3608-3626
0.001
1
6mer
3923-3949
0.001
1
6mer
27672-27695
0.001
2
6mer
14136-14161
0.001
Not Conserved
6mer
29965-29982
0.001
3
6mer
13956-13973
0.001
Not Conserved
6mer
11953-11972
0.001
Not Conserved
6mer
32900-32914
0.001
2
6mer
3120-3133
0.001
1
6mer
32147-32161
0.001
1
6mer
27242-27267
0.001
2
6mer
28289-28307
0.001
2
6mer
34592-34612
0.001
1
XLOC_010191
hsa-miR-1287-5p
0.875

Gene Details
Chromosome: chr12
Transcript: TCONS_00020911
Biotype: transcript isomorph
Gene id: XLOC_010191
Gene Name: XLOC_010191
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Lymph Node Normal/Primary
- Placenta Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
141-159
0.015
1
6mer
472-495
0.014
1
6mer
54-67
0.013
1
RP11-168O16.1
hsa-miR-1287-5p
0.875

Gene Details
Chromosome: 1
Transcript: ENST00000446333
Biotype: antisense
Gene id: ENSG00000229191
Gene Name: RP11-168O16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
137-164
0.022
2
6mer
1543-1562
0.005
7
6mer
1976-2001
0.004
2
6mer
778-802
0.004
4
6mer
1486-1503
0.002
4
6mer
635-653
0.002
2
6mer
1588-1610
0.002
3
6mer
863-878
0.001
2
XLOC_013278
hsa-miR-1287-5p
0.873

Gene Details
Chromosome: chr19
Transcript: TCONS_00027248
Biotype: transcript isomorph
Gene id: XLOC_013278
Gene Name: XLOC_013278
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Colon Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
926-949
0.031
1
6mer
1128-1148
0.010
1
6mer
1056-1082
0.001
Not Conserved
XLOC_000533
hsa-miR-1287-5p
0.872

Gene Details
Chromosome: chr1
Transcript: TCONS_00000064
Biotype: transcript isomorph
Gene id: XLOC_000533
Gene Name: XLOC_000533
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
749-769
0.034
3
7mer
530-547
0.006
2
6mer
2421-2440
0.002
1
CTBP1-AS2
hsa-miR-1287-5p
0.872

Gene Details
Chromosome: 4
Transcript: ENST00000357591
Biotype: antisense
Gene id: ENSG00000196810
Gene Name: CTBP1-AS2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
315-340
0.026
2
8mer
512-530
0.010
1
6mer
700-723
0.006
2
RP11-363G2.4
hsa-miR-1287-5p
0.871

Gene Details
Chromosome: 13
Transcript: ENST00000445646
Biotype: lincRNA
Gene id: ENSG00000229556
Gene Name: RP11-363G2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1305-1318
0.031
1
6mer
762-777
0.011
1
XLOC_007800
hsa-miR-1287-5p
0.871

Gene Details
Chromosome: chr9
Transcript: TCONS_00016434
Biotype: transcript isomorph
Gene id: XLOC_007800
Gene Name: XLOC_007800
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
3623-3641
0.023
1
7mer
1048-1063
0.009
2
7mer
211-227
0.006
1
6mer
521-538
0.004
6
6mer
1818-1842
0.001
1
XLOC_010915
hsa-miR-1287-5p
0.870

Gene Details
Chromosome: chr14
Transcript: TCONS_00022613
Biotype: transcript isomorph
Gene id: XLOC_010915
Gene Name: XLOC_010915
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2099-2117
0.022
2
7mer
1855-1869
0.016
4
6mer
1564-1589
0.003
2
6mer
1231-1256
0.001
1
PLS3-AS1
hsa-miR-1287-5p
0.869

Gene Details
Chromosome: X
Transcript: ENST00000606397
Biotype: antisense
Gene id: ENSG00000271826
Gene Name: PLS3-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
448-475
0.029
2
7mer
207-226
0.009
1
6mer
424-445
0.004
5
RP11-348J24.2
hsa-miR-1287-5p
0.869

Gene Details
Chromosome: 5
Transcript: ENST00000502934
Biotype: lincRNA
Gene id: ENSG00000250049
Gene Name: RP11-348J24.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2681-2705
0.020
1
7mer
161-183
0.016
2
6mer
254-276
0.003
3
7mer
1535-1551
0.003
2
NR2F2-AS1
hsa-miR-1287-5p
0.869

Gene Details
Chromosome: 15
Transcript: ENST00000502125
Biotype: antisense
Gene id: ENSG00000247809
Gene Name: NR2F2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
278-302
0.032
1
7mer
1464-1486
0.009
3
RP11-57H12.5
hsa-miR-1287-5p
0.868

Gene Details
Chromosome: 1
Transcript: ENST00000623609
Biotype: antisense
Gene id: ENSG00000228852
Gene Name: RP11-57H12.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
50-72
0.042
2
Funded by: