Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC092415.1
hsa-miR-1287-5p
0.972

Gene Details
Chromosome: 3
Transcript: ENST00000356047
Biotype: lincRNA
Gene id: ENSG00000235493
Gene Name: AC092415.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
236-260
0.050
1
8mer
332-351
0.018
1
RP11-691G17.1
hsa-miR-1287-5p
0.971

Gene Details
Chromosome: 3
Transcript: ENST00000567488
Biotype: lincRNA
Gene id: ENSG00000261826
Gene Name: RP11-691G17.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
219-236
0.068
1
XLOC_008072
hsa-miR-1287-5p
0.971

Gene Details
Chromosome: chrX
Transcript: TCONS_00017250
Biotype: transcript isomorph
Gene id: XLOC_008072
Gene Name: XLOC_008072
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3988-4009
0.045
2
7mer
4093-4105
0.016
1
6mer
3321-3342
0.003
2
6mer
2324-2341
0.002
2
6mer
2675-2689
0.002
1
ZBTB20-AS4
hsa-miR-1287-5p
0.971

Gene Details
Chromosome: 3
Transcript: ENST00000472323
Biotype: lincRNA
Gene id: ENSG00000242767
Gene Name: ZBTB20-AS4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
87-107
0.064
6
6mer
180-196
0.004
4
CTD-2184D3.7
hsa-miR-1287-5p
0.971

Gene Details
Chromosome: 15
Transcript: ENST00000557898
Biotype: antisense
Gene id: ENSG00000259709
Gene Name: CTD-2184D3.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
47-65
0.065
4
6mer
343-366
0.003
3
AC015849.16
hsa-miR-1287-5p
0.971

Gene Details
Chromosome: 17
Transcript: ENST00000604907
Biotype: lincRNA
Gene id: ENSG00000270977
Gene Name: AC015849.16
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
363-385
0.014
2
7mer
5003-5028
0.010
2
7mer
5171-5193
0.008
2
8mer
1161-1185
0.006
1
6mer
5063-5079
0.005
4
6mer
5352-5378
0.004
2
7mer
4766-4780
0.004
2
7mer
4706-4724
0.004
1
6mer
981-1003
0.002
2
6mer
4991-5014
0.002
2
6mer
2951-2969
0.001
3
6mer
4635-4653
0.001
1
6mer
4943-4965
0.001
2
6mer
4531-4553
0.001
1
6mer
1874-1897
0.001
1
6mer
4588-4612
0.001
1
6mer
1564-1584
0.001
1
6mer
1540-1554
0.000
2
6mer
1558-1584
0.000
2
XLOC_011677
hsa-miR-1287-5p
0.970

Gene Details
Chromosome: chr16
Transcript: TCONS_00024285
Biotype: transcript isomorph
Gene id: XLOC_011677
Gene Name: XLOC_011677
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Prostate Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
561-581
0.049
2
6mer
56-77
0.004
2
6mer
4632-4651
0.003
2
7mer
2294-2314
0.003
1
6mer
5199-5217
0.003
1
6mer
4431-4452
0.002
2
6mer
4143-4164
0.002
1
6mer
4224-4249
0.002
2
CTA-796E4.5
hsa-miR-1287-5p
0.968

Gene Details
Chromosome: 22
Transcript: ENST00000624243
Biotype: lincRNA
Gene id: ENSG00000280065
Gene Name: CTA-796E4.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
26207-26222
0.015
2
7mer
14852-14867
0.008
1
7mer
20564-20590
0.004
2
7mer
25717-25733
0.004
3
6mer
5617-5634
0.003
4
6mer
30454-30473
0.003
4
7mer
19908-19928
0.002
2
6mer
1033-1056
0.002
3
6mer
22251-22274
0.002
4
6mer
25889-25915
0.002
6
6mer
11842-11862
0.002
2
6mer
3054-3074
0.002
2
6mer
5011-5030
0.002
3
6mer
29155-29179
0.002
2
6mer
7628-7647
0.002
2
6mer
16855-16880
0.002
3
6mer
26924-26941
0.001
2
6mer
6978-6992
0.001
3
6mer
7069-7086
0.001
7
6mer
6876-6891
0.001
1
6mer
11269-11284
0.001
2
6mer
21706-21726
0.001
Not Conserved
7mer
11276-11297
0.001
1
6mer
19970-19989
0.001
1
6mer
9488-9511
0.001
2
6mer
8715-8734
0.001
2
6mer
14871-14893
0.000
2
XLOC_007165
hsa-miR-1287-5p
0.968

Gene Details
Chromosome: chr8
Transcript: TCONS_00014561
Biotype: transcript isomorph
Gene id: XLOC_007165
Gene Name: XLOC_007165
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
339-360
0.063
1
6mer
495-509
0.003
2
RP11-258C19.7
hsa-miR-1287-5p
0.967

Gene Details
Chromosome: X
Transcript: ENST00000603385
Biotype: lincRNA
Gene id: ENSG00000270189
Gene Name: RP11-258C19.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1685-1705
0.044
5
7mer
277-294
0.022
2
RP13-395E19.3
hsa-miR-1287-5p
0.967

Gene Details
Chromosome: 15
Transcript: ENST00000562108
Biotype: processed_transcript
Gene id: ENSG00000215304
Gene Name: RP13-395E19.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
738-756
0.056
5
7mer
290-306
0.006
2
6mer
765-792
0.004
3
XLOC_013553
hsa-miR-1287-5p
0.966

Gene Details
Chromosome: chr20
Transcript: TCONS_00028205
Biotype: transcript isomorph
Gene id: XLOC_013553
Gene Name: XLOC_013553
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
6160-6179
0.006
2
6mer
6324-6341
0.005
2
6mer
1186-1210
0.005
2
6mer
6212-6232
0.003
2
6mer
6426-6446
0.003
2
6mer
1720-1739
0.003
3
6mer
6480-6499
0.002
1
6mer
1930-1950
0.002
2
6mer
4388-4411
0.002
1
6mer
1505-1524
0.002
2
6mer
3508-3528
0.002
1
6mer
2437-2460
0.002
1
6mer
1244-1263
0.002
2
6mer
1297-1316
0.002
2
6mer
5864-5882
0.001
Not Conserved
6mer
3163-3183
0.001
1
6mer
1659-1683
0.001
2
6mer
4068-4091
0.001
2
6mer
2548-2565
0.001
2
6mer
1565-1576
0.001
2
6mer
2648-2671
0.001
2
6mer
2033-2056
0.001
2
6mer
1769-1792
0.001
2
6mer
1399-1422
0.001
2
6mer
2598-2618
0.001
2
6mer
3323-3342
0.001
1
6mer
1349-1369
0.001
2
6mer
2818-2830
0.001
1
6mer
2701-2724
0.001
2
6mer
4686-4704
0.001
Not Conserved
6mer
2196-2218
0.001
1
6mer
5372-5390
0.001
Not Conserved
6mer
4020-4040
0.001
Not Conserved
6mer
1983-2003
0.001
1
6mer
4180-4199
0.001
1
6mer
1609-1630
0.000
Not Conserved
6mer
3615-3637
0.000
Not Conserved
6mer
3776-3796
0.000
Not Conserved
6mer
4232-4253
0.000
Not Conserved
6mer
3830-3849
0.000
Not Conserved
6mer
3667-3690
0.000
Not Conserved
6mer
3723-3743
0.000
Not Conserved
6mer
2863-2883
0.000
Not Conserved
6mer
4106-4120
0.000
Not Conserved
6mer
3565-3581
0.000
Not Conserved
RP11-31K23.2
hsa-miR-1287-5p
0.966

Gene Details
Chromosome: 8
Transcript: ENST00000505564
Biotype: lincRNA
Gene id: ENSG00000248762
Gene Name: RP11-31K23.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
344-365
0.062
1
6mer
500-514
0.003
2
XLOC_009376
hsa-miR-1287-5p
0.966

Gene Details
Chromosome: chr11
Transcript: TCONS_00019577
Biotype: transcript isomorph
Gene id: XLOC_009376
Gene Name: XLOC_009376
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
149-166
0.066
2
CSMD2-AS1
hsa-miR-1287-5p
0.966

Gene Details
Chromosome: 1
Transcript: ENST00000414868
Biotype: antisense
Gene id: ENSG00000231163
Gene Name: CSMD2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
338-357
0.065
2
XLOC_013842
hsa-miR-1287-5p
0.965

Gene Details
Chromosome: chr20
Transcript: TCONS_00028469
Biotype: transcript isomorph
Gene id: XLOC_013842
Gene Name: XLOC_013842
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
391-403
0.065
2
XLOC_013548
hsa-miR-1287-5p
0.964

Gene Details
Chromosome: chr20
Transcript: TCONS_00028197
Biotype: transcript isomorph
Gene id: XLOC_013548
Gene Name: XLOC_013548
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Ovary Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
585-604
0.007
2
6mer
637-657
0.007
2
6mer
56-76
0.007
2
6mer
475-495
0.006
2
6mer
163-182
0.006
2
6mer
110-129
0.006
2
6mer
525-548
0.006
2
6mer
371-390
0.005
2
6mer
431-442
0.004
2
6mer
268-287
0.004
2
6mer
216-234
0.004
2
6mer
197-216
0.002
1
XLOC_010773
hsa-miR-1287-5p
0.963

Gene Details
Chromosome: chr14
Transcript: TCONS_00022436
Biotype: transcript isomorph
Gene id: XLOC_010773
Gene Name: XLOC_010773
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
169-187
0.064
2
XLOC_001979
hsa-miR-1287-5p
0.963

Gene Details
Chromosome: chr2
Transcript: TCONS_00004136
Biotype: transcript isomorph
Gene id: XLOC_001979
Gene Name: XLOC_001979
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
224-241
0.064
2
AC004951.6
hsa-miR-1287-5p
0.961

Gene Details
Chromosome: 7
Transcript: ENST00000447643
Biotype: lincRNA
Gene id: ENSG00000228434
Gene Name: AC004951.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1642-1657
0.037
1
6mer
1635-1650
0.014
1
6mer
37-60
0.013
1
Funded by: