Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-646J21.3
hsa-miR-1287-5p
0.961

Gene Details
Chromosome: 11
Transcript: ENST00000534666
Biotype: lincRNA
Gene id: ENSG00000255169
Gene Name: RP11-646J21.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
500-524
0.057
Not Conserved
6mer
118-143
0.006
3
RP1-309I22.2
hsa-miR-1287-5p
0.960

Gene Details
Chromosome: 22
Transcript: ENST00000624184
Biotype: sense_overlapping
Gene id: ENSG00000279338
Gene Name: RP1-309I22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28681-28699
0.019
3
8mer
15662-15684
0.009
4
8mer
11182-11198
0.005
2
7mer
10242-10259
0.003
2
7mer
8954-8974
0.003
2
7mer
4695-4713
0.003
3
7mer
18031-18053
0.002
2
6mer
9281-9300
0.002
3
7mer
16503-16520
0.002
2
6mer
20456-20473
0.002
2
6mer
27223-27249
0.002
4
6mer
25329-25353
0.001
5
6mer
3057-3071
0.001
2
6mer
13958-13982
0.001
2
6mer
1179-1203
0.001
2
6mer
26370-26396
0.001
2
6mer
16646-16667
0.001
2
6mer
8858-8878
0.001
2
6mer
16226-16243
0.001
1
6mer
18398-18424
0.001
1
6mer
9917-9937
0.001
1
6mer
20244-20259
0.001
1
6mer
8990-9005
0.001
5
6mer
3897-3915
0.001
1
CTD-2035E11.5
hsa-miR-1287-5p
0.958

Gene Details
Chromosome: 5
Transcript: ENST00000607250
Biotype: lincRNA
Gene id: ENSG00000272144
Gene Name: CTD-2035E11.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
172-189
0.062
2
PCGEM1
hsa-miR-1287-5p
0.957

Gene Details
Chromosome: 2
Transcript: ENST00000454040
Biotype: lincRNA
Gene id: ENSG00000227418
Gene Name: PCGEM1
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1395-1406
0.061
3
ROR1-AS1
hsa-miR-1287-5p
0.957

Gene Details
Chromosome: 1
Transcript: ENST00000424995
Biotype: antisense
Gene id: ENSG00000223949
Gene Name: ROR1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
23-42
0.055
1
7mer
1853-1878
0.006
2
CTD-2666L21.1
hsa-miR-1287-5p
0.957

Gene Details
Chromosome: 19
Transcript: ENST00000426044
Biotype: lincRNA
Gene id: ENSG00000234773
Gene Name: CTD-2666L21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
127-149
0.061
2
RP11-120D5.1
hsa-miR-1287-5p
0.957

Gene Details
Chromosome: X
Transcript: ENST00000608176
Biotype: lincRNA
Gene id: ENSG00000234129
Gene Name: RP11-120D5.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1169-1190
0.046
2
9mer
991-1010
0.013
Not Conserved
6mer
1287-1304
0.002
1
XLOC_004901
hsa-miR-1287-5p
0.956

Gene Details
Chromosome: chr5
Transcript: TCONS_00010966
Biotype: transcript isomorph
Gene id: XLOC_004901
Gene Name: XLOC_004901
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
352-379
0.057
2
6mer
1098-1109
0.004
2
XLOC_000540
hsa-miR-1287-5p
0.955

Gene Details
Chromosome: chr1
Transcript: TCONS_00001252
Biotype: transcript isomorph
Gene id: XLOC_000540
Gene Name: XLOC_000540
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Skeletal Muscle Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
17-39
0.054
2
6mer
756-775
0.006
1
RP11-40A13.1
hsa-miR-1287-5p
0.953

Gene Details
Chromosome: 17
Transcript: ENST00000584688
Biotype: antisense
Gene id: ENSG00000266535
Gene Name: RP11-40A13.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
84-106
0.048
13
6mer
95-117
0.008
11
6mer
354-375
0.004
4
XLOC_000516
hsa-miR-1287-5p
0.953

Gene Details
Chromosome: chr1
Transcript: TCONS_00001234
Biotype: transcript isomorph
Gene id: XLOC_000516
Gene Name: XLOC_000516
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Prostate Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
49-71
0.060
3
AC140912.1
hsa-miR-1287-5p
0.952

Gene Details
Chromosome: 16
Transcript: ENST00000577171
Biotype: lincRNA
Gene id: ENSG00000261227
Gene Name: AC140912.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
275-299
0.044
11
6mer
780-802
0.008
10
6mer
834-852
0.008
8
RP11-231D20.2
hsa-miR-1287-5p
0.952

Gene Details
Chromosome: 8
Transcript: ENST00000520890
Biotype: antisense
Gene id: ENSG00000253408
Gene Name: RP11-231D20.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
9-31
0.060
2
RP11-793H13.8
hsa-miR-1287-5p
0.951

Gene Details
Chromosome: 12
Transcript: ENST00000547717
Biotype: retained_intron
Gene id: ENSG00000257379
Gene Name: RP11-793H13.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1426-1440
0.039
4
7mer
211-229
0.014
7
6mer
507-528
0.004
9
6mer
1082-1100
0.002
2
SATB1-AS1
hsa-miR-1287-5p
0.951

Gene Details
Chromosome: 3
Transcript: ENST00000453361
Biotype: antisense
Gene id: ENSG00000228956
Gene Name: SATB1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
586-604
0.059
3
RP11-290L1.3
hsa-miR-1287-5p
0.951

Gene Details
Chromosome: 12
Transcript: ENST00000552367
Biotype: antisense
Gene id: ENSG00000257453
Gene Name: RP11-290L1.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
451-468
0.025
12
7mer
486-507
0.023
10
6mer
98-120
0.009
15
6mer
538-559
0.003
6
RP11-326C3.14
hsa-miR-1287-5p
0.950

Gene Details
Chromosome: 11
Transcript: ENST00000602809
Biotype: lincRNA
Gene id: ENSG00000270105
Gene Name: RP11-326C3.14
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4-16
0.020
1
7mer
238-250
0.014
1
7mer
199-211
0.013
1
7mer
43-64
0.006
Not Conserved
7mer
160-181
0.005
Not Conserved
RP11-893F2.6
hsa-miR-1287-5p
0.949

Gene Details
Chromosome: 17
Transcript: ENST00000514468
Biotype: lincRNA
Gene id: ENSG00000251085
Gene Name: RP11-893F2.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
186-207
0.055
2
6mer
82-99
0.004
2
RP13-36G14.4
hsa-miR-1287-5p
0.949

Gene Details
Chromosome: X
Transcript: ENST00000603952
Biotype: sense_intronic
Gene id: ENSG00000270223
Gene Name: RP13-36G14.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
547-569
0.058
2
XLOC_003416
hsa-miR-1287-5p
0.948

Gene Details
Chromosome: chr4
Transcript: TCONS_00007951
Biotype: transcript isomorph
Gene id: XLOC_003416
Gene Name: XLOC_003416
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
138-161
0.012
Not Conserved
7mer
1617-1642
0.010
2
7mer
363-383
0.009
1
7mer
1465-1490
0.009
1
7mer
215-235
0.008
Not Conserved
7mer
289-309
0.007
Not Conserved
6mer
1491-1515
0.003
2
Funded by: