Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-171I2.2
hsa-miR-1287-5p
0.948

Gene Details
Chromosome: 2
Transcript: ENST00000603521
Biotype: antisense
Gene id: ENSG00000270574
Gene Name: RP11-171I2.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1749-1767
0.025
10
7mer
372-389
0.024
8
6mer
338-356
0.005
8
6mer
974-995
0.004
9
RP11-197N18.2
hsa-miR-1287-5p
0.947

Gene Details
Chromosome: 12
Transcript: ENST00000540866
Biotype: retained_intron
Gene id: ENSG00000256028
Gene Name: RP11-197N18.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
560-577
0.018
2
7mer
84-107
0.010
7
6mer
5305-5331
0.006
9
6mer
296-317
0.006
8
8mer
4793-4816
0.005
5
6mer
393-418
0.002
2
6mer
432-450
0.002
2
6mer
4730-4752
0.002
4
6mer
835-859
0.002
2
6mer
4448-4462
0.002
4
6mer
2767-2791
0.001
5
6mer
1335-1353
0.001
2
6mer
3090-3106
0.001
4
XLOC_003233
hsa-miR-1287-5p
0.947

Gene Details
Chromosome: chr3
Transcript: TCONS_00006631
Biotype: transcript isomorph
Gene id: XLOC_003233
Gene Name: XLOC_003233
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
378-399
0.043
1
6mer
47-64
0.015
2
RP11-445O3.3
hsa-miR-1287-5p
0.946

Gene Details
Chromosome: 5
Transcript: ENST00000562127
Biotype: lincRNA
Gene id: ENSG00000260763
Gene Name: RP11-445O3.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1035-1055
0.019
1
7mer
952-970
0.016
1
6mer
2853-2869
0.011
1
6mer
1220-1235
0.006
1
6mer
2191-2209
0.006
1
ZFY-AS1
hsa-miR-1287-5p
0.946

Gene Details
Chromosome: Y
Transcript: ENST00000431145
Biotype: antisense
Gene id: ENSG00000233070
Gene Name: ZFY-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
375-399
0.058
1
CHKB-CPT1B
hsa-miR-1287-5p
0.945

Gene Details
Chromosome: 22
Transcript: NR_027928.2
Biotype: sense
Gene id: NR_027928.2 (gene)
Gene Name: CHKB-CPT1B
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
498-523
0.048
15
7mer
2909-2934
0.007
8
7mer
2225-2251
0.002
2
CTD-2024P10.2
hsa-miR-1287-5p
0.945

Gene Details
Chromosome: 5
Transcript: ENST00000606491
Biotype: lincRNA
Gene id: ENSG00000271874
Gene Name: CTD-2024P10.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
238-260
0.057
3
XLOC_006416
hsa-miR-1287-5p
0.944

Gene Details
Chromosome: chr7
Transcript: TCONS_00013783
Biotype: transcript isomorph
Gene id: XLOC_006416
Gene Name: XLOC_006416
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
208-235
0.057
2
RP11-92A5.2
hsa-miR-1287-5p
0.943

Gene Details
Chromosome: 4
Transcript: ENST00000511017
Biotype: antisense
Gene id: ENSG00000250538
Gene Name: RP11-92A5.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
275-289
0.054
2
6mer
1390-1415
0.003
2
RP11-312J18.6
hsa-miR-1287-5p
0.943

Gene Details
Chromosome: 1
Transcript: ENST00000427339
Biotype: lincRNA
Gene id: ENSG00000232188
Gene Name: RP11-312J18.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
525-540
0.046
1
6mer
518-535
0.010
1
RP11-423P10.2
hsa-miR-1287-5p
0.942

Gene Details
Chromosome: 2
Transcript: ENST00000606229
Biotype: sense_intronic
Gene id: ENSG00000272054
Gene Name: RP11-423P10.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
42-62
0.051
Not Conserved
6mer
3445-3465
0.006
6
RP11-96O20.2
hsa-miR-1287-5p
0.942

Gene Details
Chromosome: 15
Transcript: ENST00000557965
Biotype: lincRNA
Gene id: ENSG00000259681
Gene Name: RP11-96O20.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
10-28
0.056
2
RP11-252E2.1
hsa-miR-1287-5p
0.942

Gene Details
Chromosome: 16
Transcript: ENST00000499110
Biotype: antisense
Gene id: ENSG00000247033
Gene Name: RP11-252E2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1466-1485
0.047
1
7mer
357-376
0.006
Not Conserved
7mer
815-842
0.003
Not Conserved
XLOC_012784
hsa-miR-1287-5p
0.941

Gene Details
Chromosome: chr18
Transcript: TCONS_00026436
Biotype: transcript isomorph
Gene id: XLOC_012784
Gene Name: XLOC_012784
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HREpiC Kidney Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2158-2182
0.049
1
6mer
670-693
0.007
1
XLOC_009532
hsa-miR-1287-5p
0.940

Gene Details
Chromosome: chr11
Transcript: TCONS_00019739
Biotype: transcript isomorph
Gene id: XLOC_009532
Gene Name: XLOC_009532
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Lung Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
25-43
0.056
2
AC025171.1
hsa-miR-1287-5p
0.940

Gene Details
Chromosome: 5
Transcript: ENST00000505541
Biotype: antisense
Gene id: ENSG00000215068
Gene Name: AC025171.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HeLa Cervix Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
242-260
0.049
2
8mer
152-174
0.007
Not Conserved
XLOC_010279
hsa-miR-1287-5p
0.940

Gene Details
Chromosome: chr12
Transcript: TCONS_00020261
Biotype: transcript isomorph
Gene id: XLOC_010279
Gene Name: XLOC_010279
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2226-2247
0.044
1
6mer
198-225
0.010
1
6mer
1393-1407
0.002
Not Conserved
6mer
1308-1328
0.000
Not Conserved
AC005154.6
hsa-miR-1287-5p
0.939

Gene Details
Chromosome: 7
Transcript: ENST00000355837
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
14526-14543
0.017
6
8mer
10479-10503
0.008
2
7mer
562-582
0.008
3
7mer
14147-14172
0.006
2
6mer
8167-8185
0.002
2
8mer
9462-9482
0.002
1
6mer
13792-13812
0.002
2
6mer
5027-5052
0.002
3
7mer
8065-8086
0.001
2
6mer
2071-2085
0.001
2
6mer
2784-2805
0.001
1
6mer
4218-4239
0.001
1
6mer
13553-13570
0.001
2
6mer
13643-13666
0.001
2
6mer
11665-11683
0.001
1
6mer
4169-4187
0.001
1
XLOC_008450
hsa-miR-1287-5p
0.939

Gene Details
Chromosome: chr10
Transcript: TCONS_00018160
Biotype: transcript isomorph
Gene id: XLOC_008450
Gene Name: XLOC_008450
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
55-75
0.024
2
7mer
324-347
0.015
2
7mer
188-210
0.013
2
6mer
43-68
0.003
1
RP5-1014D13.2
hsa-miR-1287-5p
0.939

Gene Details
Chromosome: 22
Transcript: ENST00000623726
Biotype: sense_overlapping
Gene id: ENSG00000279738
Gene Name: RP5-1014D13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
19181-19203
0.010
2
7mer
4792-4811
0.007
2
7mer
11811-11837
0.006
7
7mer
557-580
0.005
2
8mer
1898-1916
0.004
3
6mer
245-266
0.004
2
6mer
296-316
0.003
1
6mer
18842-18857
0.003
3
6mer
17232-17243
0.001
2
6mer
1598-1616
0.001
6
6mer
9702-9727
0.001
2
6mer
7720-7738
0.001
1
6mer
10000-10018
0.001
Not Conserved
6mer
6113-6131
0.001
1
6mer
10368-10393
0.001
1
6mer
6483-6501
0.001
1
6mer
6806-6824
0.001
Not Conserved
6mer
7102-7120
0.001
Not Conserved
6mer
15112-15137
0.001
2
6mer
11113-11129
0.001
1
6mer
10985-11004
0.001
1
6mer
7385-7405
0.001
1
Funded by: