Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1287-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_004205
hsa-miR-1287-5p
0.938

Gene Details
Chromosome: chr4
Transcript: TCONS_00008689
Biotype: transcript isomorph
Gene id: XLOC_004205
Gene Name: XLOC_004205
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4856-4879
0.045
4
7mer
56-81
0.005
1
6mer
2307-2333
0.002
2
6mer
2983-3008
0.002
2
6mer
2811-2825
0.001
1
6mer
3509-3529
0.001
2
LINC00887
hsa-miR-1287-5p
0.937

Gene Details
Chromosome: 3
Transcript: ENST00000429578
Biotype: lincRNA
Gene id: ENSG00000214145
Gene Name: LINC00887
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
317-338
0.047
4
7mer
872-894
0.005
2
6mer
29-51
0.003
1
RP11-169D4.2
hsa-miR-1287-5p
0.937

Gene Details
Chromosome: 11
Transcript: ENST00000545254
Biotype: antisense
Gene id: ENSG00000256633
Gene Name: RP11-169D4.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
331-358
0.052
9
6mer
542-569
0.003
2
RP11-725M22.1
hsa-miR-1287-5p
0.936

Gene Details
Chromosome: 4
Transcript: ENST00000514737
Biotype: lincRNA
Gene id: ENSG00000250597
Gene Name: RP11-725M22.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28-47
0.055
1
XLOC_006466
hsa-miR-1287-5p
0.936

Gene Details
Chromosome: chr7
Transcript: TCONS_00013179
Biotype: transcript isomorph
Gene id: XLOC_006466
Gene Name: XLOC_006466
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Testes Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
793-813
0.043
Not Conserved
7mer
1141-1162
0.011
Not Conserved
RP11-132A1.4
hsa-miR-1287-5p
0.934

Gene Details
Chromosome: 7
Transcript: ENST00000419422
Biotype: antisense
Gene id: ENSG00000232445
Gene Name: RP11-132A1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
328-347
0.054
2
XLOC_009475
hsa-miR-1287-5p
0.934

Gene Details
Chromosome: chr11
Transcript: TCONS_00019671
Biotype: transcript isomorph
Gene id: XLOC_009475
Gene Name: XLOC_009475
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
Fibroblasts Foreskin Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1444-1462
0.026
1
8mer
321-345
0.025
1
6mer
788-807
0.003
3
KB-1836B5.1
hsa-miR-1287-5p
0.934

Gene Details
Chromosome: 8
Transcript: ENST00000563059
Biotype: sense_overlapping
Gene id: ENSG00000260949
Gene Name: KB-1836B5.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
342-362
0.051
2
6mer
115-133
0.003
2
MIR4500HG
hsa-miR-1287-5p
0.932

Gene Details
Chromosome: 13
Transcript: ENST00000450888
Biotype: lincRNA
Gene id: ENSG00000228824
Gene Name: MIR4500HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Kidney Normal/Primary
- Liver Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
181-200
0.053
2
LINC00928
hsa-miR-1287-5p
0.932

Gene Details
Chromosome: 15
Transcript: ENST00000561108
Biotype: lincRNA
Gene id: ENSG00000259218
Gene Name: LINC00928
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
709-731
0.047
2
6mer
649-662
0.004
1
6mer
746-772
0.003
2
RP11-967K21.1
hsa-miR-1287-5p
0.932

Gene Details
Chromosome: 12
Transcript: ENST00000617468
Biotype: antisense
Gene id: ENSG00000247934
Gene Name: RP11-967K21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
778-804
0.037
2
8mer
741-761
0.012
2
6mer
2240-2254
0.003
3
6mer
906-927
0.002
2
LINC00928
hsa-miR-1287-5p
0.930

Gene Details
Chromosome: 15
Transcript: ENST00000559967
Biotype: lincRNA
Gene id: ENSG00000259218
Gene Name: LINC00928
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
628-650
0.047
2
6mer
568-581
0.004
1
6mer
665-691
0.002
2
XLOC_011179
hsa-miR-1287-5p
0.930

Gene Details
Chromosome: chr15
Transcript: TCONS_00023310
Biotype: transcript isomorph
Gene id: XLOC_011179
Gene Name: XLOC_011179
UCSC graphic: -
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1081-1105
0.053
1
RP11-75L1.1
hsa-miR-1287-5p
0.929

Gene Details
Chromosome: 12
Transcript: ENST00000541404
Biotype: lincRNA
Gene id: ENSG00000256582
Gene Name: RP11-75L1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
513-536
0.038
1
6mer
97-113
0.015
1
RP11-618M23.4
hsa-miR-1287-5p
0.929

Gene Details
Chromosome: 8
Transcript: ENST00000521016
Biotype: lincRNA
Gene id: ENSG00000253280
Gene Name: RP11-618M23.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
286-302
0.053
1
XLOC_004180
hsa-miR-1287-5p
0.928

Gene Details
Chromosome: chr4
Transcript: TCONS_00008666
Biotype: transcript isomorph
Gene id: XLOC_004180
Gene Name: XLOC_004180
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
498-516
0.053
2
XLOC_009016
hsa-miR-1287-5p
0.928

Gene Details
Chromosome: chr11
Transcript: TCONS_00019181
Biotype: transcript isomorph
Gene id: XLOC_009016
Gene Name: XLOC_009016
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
308-334
0.038
2
6mer
584-599
0.009
2
6mer
110-134
0.005
1
XLOC_002746
hsa-miR-1287-5p
0.928

Gene Details
Chromosome: chr3
Transcript: TCONS_00006143
Biotype: transcript isomorph
Gene id: XLOC_002746
Gene Name: XLOC_002746
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
303-323
0.020
2
8mer
3755-3776
0.013
3
8mer
3922-3948
0.005
Not Conserved
7mer
4046-4058
0.005
2
7mer
6263-6288
0.003
1
6mer
361-382
0.002
3
6mer
876-886
0.002
4
6mer
4673-4698
0.001
1
RP11-169K16.4
hsa-miR-1287-5p
0.927

Gene Details
Chromosome: 1
Transcript: ENST00000418525
Biotype: antisense
Gene id: ENSG00000224459
Gene Name: RP11-169K16.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
595-613
0.033
6
7mer
45-67
0.013
2
7mer
39-57
0.007
2
ARHGEF38-IT1
hsa-miR-1287-5p
0.927

Gene Details
Chromosome: 4
Transcript: ENST00000512262
Biotype: sense_intronic
Gene id: ENSG00000249885
Gene Name: ARHGEF38-IT1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1287-5p
Sequence: ugcuggaucagugguucgaguc
MirBase ID: MIMAT0005878
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
193-214
0.038
6
7mer
298-323
0.015
3
Funded by: