Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC092669.6
hsa-miR-1302
0.867

Gene Details
Chromosome: 2
Transcript: ENST00000412313
Biotype: lincRNA
Gene id: ENSG00000225815
Gene Name: AC092669.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
566-572
0.041
7
CTA-212A2.3
hsa-miR-1302
0.867

Gene Details
Chromosome: 22
Transcript: ENST00000624264
Biotype: lincRNA
Gene id: ENSG00000279217
Gene Name: CTA-212A2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
11700-11725
0.004
2
6mer
325-351
0.004
2
6mer
620-642
0.003
1
6mer
738-742
0.003
2
6mer
497-505
0.003
1
6mer
1041-1066
0.002
1
6mer
10558-10583
0.002
1
6mer
13247-13273
0.002
1
6mer
11635-11645
0.002
2
6mer
11322-11334
0.002
2
6mer
8799-8803
0.002
2
6mer
9904-9908
0.002
2
6mer
4278-4288
0.002
2
6mer
6039-6043
0.001
2
6mer
4941-4967
0.001
2
6mer
1296-1319
0.001
1
6mer
10693-10719
0.001
2
6mer
1849-1869
0.001
1
6mer
1196-1200
0.001
1
6mer
12663-12683
0.001
Not Conserved
6mer
13393-13408
0.001
1
6mer
3191-3211
0.001
Not Conserved
6mer
2330-2357
0.001
Not Conserved
CTD-2587H24.5
hsa-miR-1302
0.867

Gene Details
Chromosome: 19
Transcript: ENST00000591665
Biotype: antisense
Gene id: ENSG00000267577
Gene Name: CTD-2587H24.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1589-1601
0.038
Not Conserved
6mer
227-252
0.002
Not Conserved
6mer
950-972
0.001
1
RP11-206L10.3
hsa-miR-1302
0.866

Gene Details
Chromosome: 1
Transcript: ENST00000416385
Biotype: lincRNA
Gene id: ENSG00000235373
Gene Name: RP11-206L10.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
4588-4592
0.015
1
6mer
4119-4127
0.010
1
6mer
3988-4014
0.007
1
6mer
1812-1829
0.005
1
6mer
645-662
0.002
Not Conserved
6mer
2351-2361
0.001
Not Conserved
RP11-61A14.4
hsa-miR-1302
0.866

Gene Details
Chromosome: 16
Transcript: ENST00000501143
Biotype: lincRNA
Gene id: ENSG00000246777
Gene Name: RP11-61A14.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2791-2797
0.038
1
6mer
2606-2618
0.003
2
WDR11-AS1
hsa-miR-1302
0.865

Gene Details
Chromosome: 10
Transcript: ENST00000598981
Biotype: antisense
Gene id: ENSG00000227165
Gene Name: WDR11-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1998-2016
0.038
1
6mer
557-582
0.003
2
RP11-219B17.1
hsa-miR-1302
0.865

Gene Details
Chromosome: 15
Transcript: ENST00000559902
Biotype: antisense
Gene id: ENSG00000245534
Gene Name: RP11-219B17.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
174-186
0.041
2
RP11-214O1.3
hsa-miR-1302
0.864

Gene Details
Chromosome: 17
Transcript: ENST00000584683
Biotype: lincRNA
Gene id: ENSG00000266378
Gene Name: RP11-214O1.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1772-1799
0.034
2
6mer
30-54
0.004
1
6mer
1396-1416
0.003
2
LINC01278
hsa-miR-1302
0.863

Gene Details
Chromosome: X
Transcript: ENST00000608623
Biotype: retained_intron
Gene id: ENSG00000235437
Gene Name: LINC01278
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
20-36
0.016
2
6mer
198-208
0.014
2
8mer
4465-4472
0.009
Not Conserved
6mer
2646-2662
0.002
Not Conserved
RP11-206L10.9
hsa-miR-1302
0.863

Gene Details
Chromosome: 1
Transcript: ENST00000591702
Biotype: lincRNA
Gene id: ENSG00000237491
Gene Name: RP11-206L10.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1344-1357
0.022
Not Conserved
7mer
487-502
0.006
Not Conserved
7mer
407-432
0.005
Not Conserved
6mer
198-212
0.004
Not Conserved
6mer
510-525
0.002
Not Conserved
6mer
643-669
0.002
Not Conserved
XLOC_009308
hsa-miR-1302
0.863

Gene Details
Chromosome: chr11
Transcript: TCONS_00019510
Biotype: transcript isomorph
Gene id: XLOC_009308
Gene Name: XLOC_009308
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
214-227
0.041
2
RP11-542M13.2
hsa-miR-1302
0.862

Gene Details
Chromosome: 16
Transcript: ENST00000599411
Biotype: lincRNA
Gene id: ENSG00000269667
Gene Name: RP11-542M13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
285-311
0.037
2
6mer
238-257
0.004
1
CYP4F35P
hsa-miR-1302
0.862

Gene Details
Chromosome: 18
Transcript: ENST00000582957
Biotype: lincRNA
Gene id: ENSG00000265787
Gene Name: CYP4F35P
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
280-300
0.016
1
7mer
336-360
0.007
1
6mer
2772-2776
0.006
1
6mer
321-334
0.005
1
6mer
2175-2192
0.004
1
6mer
1269-1273
0.003
1
LINC00608
hsa-miR-1302
0.861

Gene Details
Chromosome: 2
Transcript: NR_024385.1
Biotype: lincRNA
Gene id: NR_024385.1 (gene)
Gene Name: LINC00608
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
13-35
0.018
2
8mer
1274-1294
0.018
1
6mer
1041-1051
0.005
3
RP11-708H21.4
hsa-miR-1302
0.861

Gene Details
Chromosome: 17
Transcript: ENST00000575159
Biotype: lincRNA
Gene id: ENSG00000262973
Gene Name: RP11-708H21.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
193-211
0.034
2
6mer
954-970
0.006
1
RP11-370B11.3
hsa-miR-1302
0.860

Gene Details
Chromosome: 9
Transcript: ENST00000448570
Biotype: lincRNA
Gene id: ENSG00000224549
Gene Name: RP11-370B11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
20-34
0.040
1
XLOC_013557
hsa-miR-1302
0.860

Gene Details
Chromosome: chr20
Transcript: TCONS_00027944
Biotype: transcript isomorph
Gene id: XLOC_013557
Gene Name: XLOC_013557
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
Fibroblasts Lung Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
437-457
0.032
2
6mer
83-87
0.004
1
6mer
30-55
0.004
1
LINC00654
hsa-miR-1302
0.859

Gene Details
Chromosome: 20
Transcript: NR_015406.1
Biotype: lincRNA
Gene id: NR_015406.1 (gene)
Gene Name: LINC00654
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
543-552
0.037
4
6mer
1020-1047
0.003
2
bP-2189O9.3
hsa-miR-1302
0.859

Gene Details
Chromosome: 21
Transcript: ENST00000623794
Biotype: lincRNA
Gene id: ENSG00000279579
Gene Name: bP-2189O9.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
374-380
0.029
1
6mer
223-236
0.011
1
RP1-149A16.19
hsa-miR-1302
0.858

Gene Details
Chromosome: 22
Transcript: ENST00000625072
Biotype: lincRNA
Gene id: ENSG00000280361
Gene Name: RP1-149A16.19
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
299-320
0.027
Not Conserved
7mer
829-853
0.009
1
6mer
640-650
0.005
1
Funded by: