Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP1-197B17.5
hsa-miR-1302
0.929

Gene Details
Chromosome: 12
Transcript: ENST00000611728
Biotype: sense_intronic
Gene id: ENSG00000276390
Gene Name: RP1-197B17.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
80-106
0.053
1
LINC00910
hsa-miR-1302
0.928

Gene Details
Chromosome: 17
Transcript: ENST00000341011
Biotype: lincRNA
Gene id: ENSG00000188825
Gene Name: LINC00910
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25-31
0.049
1
6mer
365-369
0.004
1
XLOC_000017
hsa-miR-1302
0.928

Gene Details
Chromosome: chr1
Transcript: TCONS_00000801
Biotype: transcript isomorph
Gene id: XLOC_000017
Gene Name: XLOC_000017
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
442-446
0.007
2
6mer
403-407
0.007
2
6mer
364-368
0.006
2
6mer
271-291
0.006
2
6mer
233-253
0.006
2
6mer
44-61
0.004
1
6mer
160-177
0.004
1
6mer
195-215
0.004
1
6mer
96-100
0.004
1
6mer
118-138
0.004
1
MIR29B1
hsa-miR-1302
0.927

Gene Details
Chromosome: 7
Transcript: ENST00000447307
Biotype: lincRNA
Gene id: ENSG00000226380
Gene Name: MIR29B1
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
138-163
0.052
2
AF131216.6
hsa-miR-1302
0.926

Gene Details
Chromosome: 8
Transcript: ENST00000498997
Biotype: antisense
Gene id: ENSG00000246477
Gene Name: AF131216.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5514-5535
0.016
3
9mer
4281-4288
0.014
3
6mer
233-237
0.005
2
8mer
2512-2527
0.005
2
6mer
5589-5604
0.004
2
6mer
5572-5596
0.004
3
6mer
4464-4476
0.002
1
6mer
4628-4642
0.002
2
XLOC_001668
hsa-miR-1302
0.925

Gene Details
Chromosome: chr2
Transcript: TCONS_00003870
Biotype: transcript isomorph
Gene id: XLOC_001668
Gene Name: XLOC_001668
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
214-228
0.028
2
6mer
5277-5304
0.008
2
7mer
2284-2294
0.007
1
6mer
3791-3814
0.006
2
6mer
3869-3891
0.003
2
KRT73-AS1
hsa-miR-1302
0.923

Gene Details
Chromosome: 12
Transcript: ENST00000552364
Biotype: antisense
Gene id: ENSG00000257495
Gene Name: KRT73-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3620-3633
0.020
2
9mer
3620-3643
0.015
Not Conserved
6mer
3509-3521
0.004
4
7mer
2398-2410
0.003
Not Conserved
6mer
326-351
0.003
1
6mer
483-487
0.003
2
6mer
745-758
0.001
1
6mer
2464-2477
0.001
2
7mer
2411-2429
0.001
2
PCAT14
hsa-miR-1302
0.920

Gene Details
Chromosome: 22
Transcript: NR_109832.1
Biotype: lincRNA
Gene id: NR_109832.1 (gene)
Gene Name: PCAT14
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
261-277
0.051
1
RP11-457M11.7
hsa-miR-1302
0.919

Gene Details
Chromosome: 6
Transcript: ENST00000616994
Biotype: lincRNA
Gene id: ENSG00000275846
Gene Name: RP11-457M11.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2080-2087
0.032
Not Conserved
7mer
2919-2932
0.015
2
6mer
863-876
0.003
2
XLOC_005311
hsa-miR-1302
0.919

Gene Details
Chromosome: chr6
Transcript: TCONS_00011825
Biotype: transcript isomorph
Gene id: XLOC_005311
Gene Name: XLOC_005311
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
140-155
0.030
1
7mer
49-69
0.020
2
XLOC_000191
hsa-miR-1302
0.919

Gene Details
Chromosome: chr1
Transcript: TCONS_00000939
Biotype: transcript isomorph
Gene id: XLOC_000191
Gene Name: XLOC_000191
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
43-47
0.018
2
6mer
157-178
0.015
2
6mer
438-450
0.012
2
6mer
1407-1422
0.003
1
6mer
517-531
0.002
Not Conserved
AC092669.2
hsa-miR-1302
0.919

Gene Details
Chromosome: 2
Transcript: ENST00000437790
Biotype: lincRNA
Gene id: ENSG00000241254
Gene Name: AC092669.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
566-572
0.050
7
LINC01088
hsa-miR-1302
0.918

Gene Details
Chromosome: 4
Transcript: ENST00000437737
Biotype: antisense
Gene id: ENSG00000249307
Gene Name: LINC01088
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
24-40
0.047
6
6mer
450-454
0.003
1
RP3-412A9.17
hsa-miR-1302
0.917

Gene Details
Chromosome: 22
Transcript: ENST00000623789
Biotype: sense_overlapping
Gene id: ENSG00000278920
Gene Name: RP3-412A9.17
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
11164-11190
0.012
2
6mer
3708-3730
0.003
6
6mer
57-77
0.003
1
6mer
6330-6354
0.003
4
6mer
3867-3880
0.003
7
6mer
15844-15869
0.002
2
6mer
701-717
0.002
Not Conserved
6mer
876-896
0.002
1
6mer
8013-8028
0.002
2
6mer
3157-3183
0.002
2
6mer
10480-10488
0.002
2
6mer
9584-9588
0.002
1
6mer
13977-13981
0.001
2
6mer
7487-7513
0.001
1
6mer
2539-2552
0.001
1
6mer
11842-11862
0.001
2
6mer
7285-7289
0.001
1
6mer
2667-2687
0.001
2
6mer
14779-14804
0.001
1
6mer
9307-9317
0.001
1
6mer
14912-14938
0.001
2
6mer
15220-15238
0.001
Not Conserved
6mer
7644-7648
0.001
1
7mer
10555-10566
0.001
1
XLOC_010017
hsa-miR-1302
0.916

Gene Details
Chromosome: chr12
Transcript: TCONS_00020167
Biotype: transcript isomorph
Gene id: XLOC_010017
Gene Name: XLOC_010017
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
184-190
0.050
2
RP11-378A12.1
hsa-miR-1302
0.915

Gene Details
Chromosome: 8
Transcript: ENST00000612422
Biotype: lincRNA
Gene id: ENSG00000277526
Gene Name: RP11-378A12.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
428-450
0.024
1
8mer
88-106
0.022
1
6mer
1040-1044
0.003
2
C20orf166-AS1
hsa-miR-1302
0.915

Gene Details
Chromosome: 20
Transcript: ENST00000621644
Biotype: antisense
Gene id: ENSG00000174403
Gene Name: C20orf166-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
189-201
0.038
2
6mer
152-163
0.006
2
6mer
13-26
0.006
2
CTC-360P9.1
hsa-miR-1302
0.914

Gene Details
Chromosome: 19
Transcript: ENST00000592270
Biotype: lincRNA
Gene id: ENSG00000267012
Gene Name: CTC-360P9.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
189-211
0.049
8
AC108488.4
hsa-miR-1302
0.914

Gene Details
Chromosome: 2
Transcript: ENST00000422961
Biotype: lincRNA
Gene id: ENSG00000242282
Gene Name: AC108488.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
664-678
0.018
2
7mer
624-643
0.016
1
7mer
636-655
0.016
1
ADAMTS9-AS1
hsa-miR-1302
0.914

Gene Details
Chromosome: 3
Transcript: ENST00000471990
Biotype: antisense
Gene id: ENSG00000241158
Gene Name: ADAMTS9-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
149-166
0.049
2
Funded by: