Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-543C4.3
hsa-miR-1302
0.894

Gene Details
Chromosome: 14
Transcript: ENST00000555875
Biotype: lincRNA
Gene id: ENSG00000258672
Gene Name: RP11-543C4.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
76-82
0.042
1
6mer
241-268
0.004
2
RP11-46H11.3
hsa-miR-1302
0.892

Gene Details
Chromosome: 12
Transcript: ENST00000503695
Biotype: lincRNA
Gene id: ENSG00000250790
Gene Name: RP11-46H11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2092-2119
0.012
1
6mer
340-361
0.011
1
6mer
1755-1769
0.006
1
6mer
2065-2075
0.006
1
6mer
1916-1941
0.005
1
6mer
1493-1507
0.005
1
RP11-34P13.13
hsa-miR-1302
0.892

Gene Details
Chromosome: 1
Transcript: ENST00000484859
Biotype: antisense
Gene id: ENSG00000241860
Gene Name: RP11-34P13.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
4588-4592
0.015
2
6mer
4119-4127
0.010
2
6mer
3988-4014
0.008
2
6mer
1812-1829
0.005
2
6mer
645-662
0.004
1
6mer
2354-2364
0.002
1
RP5-1136G13.2
hsa-miR-1302
0.892

Gene Details
Chromosome: 7
Transcript: ENST00000610085
Biotype: antisense
Gene id: ENSG00000273314
Gene Name: RP5-1136G13.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
753-760
0.042
1
6mer
1856-1871
0.003
2
XLOC_003930
hsa-miR-1302
0.892

Gene Details
Chromosome: chr4
Transcript: TCONS_00008469
Biotype: transcript isomorph
Gene id: XLOC_003930
Gene Name: XLOC_003930
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
208-222
0.045
2
RP11-989E6.10
hsa-miR-1302
0.891

Gene Details
Chromosome: 16
Transcript: ENST00000568752
Biotype: lincRNA
Gene id: ENSG00000261200
Gene Name: RP11-989E6.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2190-2196
0.013
1
7mer
3781-3797
0.010
1
7mer
3604-3622
0.008
1
6mer
65-92
0.007
1
8mer
1870-1877
0.006
1
TTTY13
hsa-miR-1302
0.888

Gene Details
Chromosome: Y
Transcript: ENST00000330337
Biotype: lincRNA
Gene id: ENSG00000184991
Gene Name: TTTY13
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
493-501
0.041
Not Conserved
6mer
220-233
0.004
Not Conserved
RP11-29H23.4
hsa-miR-1302
0.888

Gene Details
Chromosome: 1
Transcript: ENST00000456382
Biotype: antisense
Gene id: ENSG00000232519
Gene Name: RP11-29H23.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
126-139
0.045
5
LINC00665
hsa-miR-1302
0.888

Gene Details
Chromosome: 19
Transcript: ENST00000590657
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2363-2381
0.014
2
6mer
2162-2166
0.012
2
6mer
445-455
0.011
2
6mer
1179-1205
0.007
2
LINC00657
hsa-miR-1302
0.888

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
319-336
0.039
4
6mer
161-182
0.006
2
XLOC_007663
hsa-miR-1302
0.888

Gene Details
Chromosome: chr9
Transcript: TCONS_00016287
Biotype: transcript isomorph
Gene id: XLOC_007663
Gene Name: XLOC_007663
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
288-303
0.044
2
LINC00856
hsa-miR-1302
0.887

Gene Details
Chromosome: 10
Transcript: ENST00000624665
Biotype: lincRNA
Gene id: ENSG00000230417
Gene Name: LINC00856
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
998-1015
0.035
3
6mer
1218-1230
0.006
5
6mer
1005-1022
0.003
2
XLOC_000964
hsa-miR-1302
0.887

Gene Details
Chromosome: chr1
Transcript: TCONS_00001629
Biotype: transcript isomorph
Gene id: XLOC_000964
Gene Name: XLOC_000964
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2418-2431
0.040
5
6mer
2072-2080
0.004
7
LINC01197
hsa-miR-1302
0.887

Gene Details
Chromosome: 15
Transcript: ENST00000614853
Biotype: lincRNA
Gene id: ENSG00000248441
Gene Name: LINC01197
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
451-474
0.036
2
6mer
276-292
0.004
2
6mer
247-264
0.004
1
LINC00906
hsa-miR-1302
0.886

Gene Details
Chromosome: 19
Transcript: ENST00000589921
Biotype: lincRNA
Gene id: ENSG00000267339
Gene Name: LINC00906
UCSC graphic:
Expression:
  Cell Line Tissue Category
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3267-3288
0.027
2
8mer
1386-1392
0.008
2
6mer
3400-3425
0.005
3
6mer
2716-2741
0.002
2
6mer
1543-1561
0.002
4
BCYRN1
hsa-miR-1302
0.886

Gene Details
Chromosome: 2
Transcript: ENST00000418539
Biotype: lincRNA
Gene id: ENSG00000236824
Gene Name: BCYRN1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
5551-5577
0.012
2
7mer
201-213
0.007
2
7mer
1777-1793
0.005
2
6mer
157-184
0.004
2
6mer
11993-12018
0.002
2
6mer
5039-5043
0.002
2
6mer
8507-8532
0.002
2
6mer
7920-7933
0.002
2
6mer
6867-6893
0.001
1
6mer
10371-10375
0.001
1
6mer
3698-3702
0.001
2
6mer
11372-11387
0.001
2
6mer
8665-8669
0.001
2
6mer
2826-2842
0.001
1
6mer
1865-1885
0.001
2
6mer
8048-8068
0.001
2
RP13-580B18.4
hsa-miR-1302
0.884

Gene Details
Chromosome: 7
Transcript: ENST00000624628
Biotype: lincRNA
Gene id: ENSG00000279072
Gene Name: RP13-580B18.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
20253-20268
0.004
1
6mer
23930-23955
0.003
Not Conserved
7mer
4977-4993
0.003
Not Conserved
6mer
23500-23510
0.003
1
6mer
914-918
0.002
1
6mer
23064-23083
0.002
1
6mer
23365-23381
0.002
1
6mer
18999-19019
0.002
1
6mer
10641-10660
0.001
1
6mer
21983-21995
0.001
Not Conserved
6mer
6917-6936
0.001
Not Conserved
6mer
16212-16231
0.001
Not Conserved
6mer
5127-5146
0.001
Not Conserved
6mer
12623-12642
0.001
Not Conserved
7mer
21749-21766
0.001
Not Conserved
7mer
21698-21713
0.001
Not Conserved
6mer
8803-8822
0.001
Not Conserved
6mer
3385-3404
0.001
Not Conserved
6mer
14470-14489
0.001
Not Conserved
6mer
18050-18069
0.001
Not Conserved
6mer
3036-3054
0.001
Not Conserved
6mer
17701-17719
0.001
Not Conserved
6mer
14112-14130
0.001
Not Conserved
6mer
12274-12292
0.001
Not Conserved
6mer
9051-9061
0.001
Not Conserved
6mer
15863-15881
0.001
Not Conserved
6mer
10292-10310
0.001
Not Conserved
6mer
4778-4796
0.001
Not Conserved
6mer
8454-8472
0.001
Not Conserved
6mer
6568-6586
0.001
Not Conserved
6mer
20209-20228
0.001
1
LCMT1-AS2
hsa-miR-1302
0.884

Gene Details
Chromosome: 16
Transcript: ENST00000565214
Biotype: antisense
Gene id: ENSG00000260034
Gene Name: LCMT1-AS2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4997-5002
0.032
2
6mer
1419-1442
0.006
2
6mer
3956-3971
0.006
2
XLOC_003809
hsa-miR-1302
0.883

Gene Details
Chromosome: chr4
Transcript: TCONS_00008359
Biotype: transcript isomorph
Gene id: XLOC_003809
Gene Name: XLOC_003809
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3898-3903
0.013
1
8mer
1681-1697
0.005
1
6mer
92-113
0.003
Not Conserved
6mer
210-229
0.003
2
6mer
65-84
0.003
Not Conserved
6mer
4077-4097
0.003
1
6mer
239-258
0.003
1
6mer
152-171
0.002
1
6mer
123-142
0.002
Not Conserved
6mer
181-200
0.002
1
6mer
1058-1084
0.002
1
6mer
2566-2570
0.001
2
6mer
2411-2436
0.001
1
RP11-982M15.8
hsa-miR-1302
0.881

Gene Details
Chromosome: 14
Transcript: ENST00000564585
Biotype: lincRNA
Gene id: ENSG00000260792
Gene Name: RP11-982M15.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
234-252
0.023
2
6mer
347-366
0.008
3
7mer
1440-1458
0.003
2
6mer
1914-1938
0.003
2
6mer
1780-1784
0.002
2
6mer
2219-2223
0.002
2
6mer
1563-1576
0.002
2
6mer
2369-2395
0.001
Not Conserved
Funded by: