Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AP000708.1
hsa-miR-1302
0.999

Gene Details
Chromosome: 11
Transcript: ENST00000527818
Biotype: antisense
Gene id: ENSG00000255537
Gene Name: AP000708.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1069-1094
0.018
1
8mer
2042-2055
0.015
1
8mer
2352-2365
0.010
1
8mer
2118-2131
0.007
2
8mer
2326-2339
0.007
1
8mer
2144-2157
0.007
1
8mer
2248-2261
0.007
2
8mer
2300-2313
0.007
1
8mer
2274-2287
0.007
1
8mer
2222-2235
0.006
1
8mer
2068-2081
0.006
1
8mer
2196-2209
0.006
1
8mer
2170-2183
0.006
1
8mer
2094-2107
0.006
1
7mer
1746-1766
0.004
1
6mer
1186-1206
0.001
2
KCNQ1OT1
hsa-miR-1302
0.998

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
4832-4856
0.011
2
7mer
79318-79335
0.008
2
8mer
58356-58363
0.005
3
7mer
86825-86835
0.005
2
7mer
76733-76742
0.005
4
7mer
35886-35911
0.004
1
7mer
70429-70456
0.004
2
8mer+wobble
50616-50632
0.004
1
7mer
73114-73137
0.003
3
7mer
82242-82257
0.003
2
6mer
90973-90997
0.002
2
7mer
90868-90892
0.002
1
6mer
37487-37506
0.002
1
6mer
21331-21358
0.002
1
6mer
50032-50036
0.002
2
6mer
61320-61335
0.002
1
6mer
44293-44319
0.002
4
6mer
73160-73164
0.002
2
6mer
18652-18662
0.002
1
6mer
39392-39407
0.002
1
6mer
22108-22126
0.002
2
6mer
52456-52472
0.002
3
6mer
72504-72514
0.002
2
6mer
82621-82637
0.002
3
6mer
64261-64275
0.002
2
6mer
85783-85804
0.002
3
6mer
6612-6616
0.002
2
6mer
81034-81047
0.002
3
6mer
36850-36869
0.002
1
6mer
63375-63379
0.001
1
6mer
82841-82860
0.001
4
6mer
23748-23752
0.001
1
6mer
2431-2452
0.001
1
6mer
89833-89844
0.001
Not Conserved
6mer
17375-17390
0.001
2
6mer
90539-90564
0.001
1
6mer
75366-75388
0.001
2
6mer
65445-65460
0.001
2
6mer
77374-77394
0.001
2
6mer
3025-3045
0.001
2
6mer
44616-44629
0.001
Not Conserved
6mer
71699-71719
0.001
1
6mer
32091-32107
0.001
1
6mer
23613-23617
0.001
1
6mer
76025-76039
0.001
2
6mer
59585-59595
0.001
2
6mer
23255-23269
0.001
Not Conserved
6mer
73439-73456
0.001
2
6mer
77955-77980
0.001
1
6mer
31665-31680
0.001
1
6mer
2910-2934
0.001
1
6mer
35715-35733
0.001
1
6mer
35820-35824
0.001
1
6mer
77907-77934
0.000
2
RP11-78B10.2
hsa-miR-1302
0.998

Gene Details
Chromosome: 1
Transcript: ENST00000439443
Biotype: antisense
Gene id: ENSG00000236911
Gene Name: RP11-78B10.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
113-138
0.114
4
XLOC_006124
hsa-miR-1302
0.998

Gene Details
Chromosome: chr7
Transcript: TCONS_00014152
Biotype: transcript isomorph
Gene id: XLOC_006124
Gene Name: XLOC_006124
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
274-290
0.109
2
XLOC_000616
hsa-miR-1302
0.997

Gene Details
Chromosome: chr1
Transcript: TCONS_00001326
Biotype: transcript isomorph
Gene id: XLOC_000616
Gene Name: XLOC_000616
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
449-473
0.100
2
6mer
281-299
0.006
3
RP11-344E13.3
hsa-miR-1302
0.997

Gene Details
Chromosome: 17
Transcript: ENST00000433763
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
49-61
0.056
1
6mer
77-81
0.019
1
6mer
139-159
0.015
1
6mer
324-328
0.015
1
MIR6818
hsa-miR-1302
0.996

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
15075-15088
0.020
4
8mer
47935-47953
0.007
1
7mer
13718-13723
0.006
3
7mer
12796-12808
0.004
2
6mer
197-219
0.004
2
6mer
301-311
0.003
1
7mer
39179-39190
0.003
1
6mer
1201-1210
0.003
6
6mer
25794-25804
0.003
4
6mer
17725-17734
0.002
5
6mer
43031-43053
0.002
5
6mer
13992-14002
0.002
5
7mer
20371-20376
0.002
2
6mer
23319-23338
0.002
4
6mer
25479-25502
0.002
2
6mer
33689-33693
0.002
2
6mer
30477-30496
0.002
4
6mer
11438-11442
0.002
4
6mer
39685-39711
0.002
2
6mer
38822-38840
0.002
4
6mer
33546-33562
0.002
10
6mer
46982-46995
0.002
2
6mer
47484-47504
0.001
2
6mer
32317-32321
0.001
2
6mer
6308-6321
0.001
2
6mer
22200-22204
0.001
2
6mer
20955-20980
0.001
2
6mer
44182-44202
0.001
2
6mer
40012-40022
0.001
1
6mer
11176-11201
0.001
1
6mer
21270-21274
0.001
1
6mer
17911-17926
0.001
2
6mer
45237-45241
0.001
1
6mer
19451-19455
0.001
1
6mer
32289-32304
0.001
6
6mer
2642-2668
0.001
2
6mer
20452-20468
0.001
2
6mer
7112-7130
0.001
2
6mer
3018-3022
0.001
1
6mer
31965-31985
0.001
2
6mer
30384-30401
0.001
2
6mer
20824-20846
0.001
2
6mer
45103-45129
0.001
2
6mer
39550-39575
0.001
2
6mer
47314-47331
0.001
2
RP11-759A24.3
hsa-miR-1302
0.996

Gene Details
Chromosome: 15
Transcript: ENST00000619812
Biotype: lincRNA
Gene id: ENSG00000275443
Gene Name: RP11-759A24.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
659-675
0.102
10
RP11-139I14.2
hsa-miR-1302
0.996

Gene Details
Chromosome: 1
Transcript: ENST00000451362
Biotype: lincRNA
Gene id: ENSG00000237390
Gene Name: RP11-139I14.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
803-814
0.060
9
8mer
4785-4810
0.020
2
7mer
4400-4422
0.015
9
6mer
3502-3520
0.002
3
6mer
2376-2393
0.001
2
6mer
1795-1805
0.001
1
RP11-192P3.4
hsa-miR-1302
0.993

Gene Details
Chromosome: 10
Transcript: ENST00000605929
Biotype: lincRNA
Gene id: ENSG00000272381
Gene Name: RP11-192P3.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2092-2110
0.091
9
6mer
788-810
0.002
2
AC006548.28
hsa-miR-1302
0.993

Gene Details
Chromosome: 22
Transcript: ENST00000623130
Biotype: sense_overlapping
Gene id: ENSG00000280156
Gene Name: AC006548.28
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
14144-14166
0.006
2
7mer
34651-34670
0.005
2
8mer+wobble
74282-74300
0.005
2
7mer
81502-81518
0.003
2
7mer
82259-82279
0.003
2
7mer
27929-27943
0.003
2
7mer
77024-77036
0.003
1
7mer
53577-53591
0.002
Not Conserved
7mer
5237-5261
0.002
2
6mer
20260-20282
0.002
2
6mer
50666-50670
0.002
Not Conserved
6mer
26426-26450
0.002
2
6mer
46214-46222
0.002
Not Conserved
6mer
10914-10928
0.002
2
6mer
8118-8129
0.002
3
6mer
24381-24401
0.002
2
6mer
58749-58773
0.002
2
6mer
32684-32696
0.002
2
7mer
25456-25470
0.002
2
6mer
14751-14761
0.002
2
7mer
61985-62004
0.002
2
7mer
62952-62968
0.002
2
6mer
58298-58302
0.002
2
6mer
71690-71713
0.001
Not Conserved
6mer
69674-69688
0.001
1
6mer
2499-2520
0.001
1
6mer
21001-21026
0.001
1
6mer
58432-58436
0.001
2
6mer
55691-55709
0.001
2
6mer
42769-42795
0.001
1
6mer
78029-78047
0.001
1
6mer
64961-64981
0.001
2
6mer
36593-36598
0.001
2
6mer
29852-29870
0.001
2
6mer
10292-10312
0.001
2
6mer
8870-8874
0.001
Not Conserved
6mer
24740-24745
0.001
2
6mer
10482-10491
0.001
1
6mer
49281-49294
0.001
Not Conserved
6mer
79590-79612
0.001
1
6mer
34523-34532
0.001
2
6mer
72135-72139
0.001
Not Conserved
6mer
9538-9563
0.001
2
6mer
57424-57428
0.001
1
6mer
12397-12412
0.001
2
6mer
29708-29733
0.001
1
6mer
22555-22571
0.001
2
6mer
58117-58122
0.001
2
6mer
71998-72002
0.001
Not Conserved
6mer
10160-10177
0.001
2
6mer
42176-42198
0.001
Not Conserved
6mer
60546-60564
0.001
Not Conserved
6mer
51863-51878
0.001
Not Conserved
LOC100190986
hsa-miR-1302
0.992

Gene Details
Chromosome: 16
Transcript: NR_024456.1
Biotype: sense
Gene id: NR_024456.1 (gene)
Gene Name: LOC100190986
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2170-2189
0.048
1
6mer
2330-2334
0.017
1
6mer
2196-2221
0.014
1
6mer
548-552
0.011
1
CTD-2218K11.2
hsa-miR-1302
0.992

Gene Details
Chromosome: 5
Transcript: ENST00000509506
Biotype: lincRNA
Gene id: ENSG00000249100
Gene Name: CTD-2218K11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
615-641
0.089
4
FAM155A-IT1
hsa-miR-1302
0.991

Gene Details
Chromosome: 13
Transcript: ENST00000449551
Biotype: sense_intronic
Gene id: ENSG00000227248
Gene Name: FAM155A-IT1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
21-33
0.087
2
RP11-92C4.6
hsa-miR-1302
0.989

Gene Details
Chromosome: 9
Transcript: ENST00000605631
Biotype: antisense
Gene id: ENSG00000270412
Gene Name: RP11-92C4.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
165-177
0.075
4
7mer
157-177
0.010
2
MIR4534
hsa-miR-1302
0.987

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
53702-53719
0.006
1
8mer
36023-36047
0.005
7
8mer
41865-41886
0.004
3
7mer
35706-35711
0.004
6
6mer
341-345
0.003
1
7mer
18300-18316
0.002
1
6mer
909-925
0.002
2
7mer
50877-50895
0.002
2
6mer
41266-41270
0.002
2
6mer
1225-1233
0.002
3
7mer
50160-50186
0.002
3
6mer
14896-14900
0.002
2
6mer
16912-16916
0.002
2
6mer
43002-43028
0.001
2
6mer
6206-6210
0.001
2
6mer
7838-7864
0.001
2
6mer
44304-44308
0.001
2
6mer
1995-2021
0.001
2
6mer
39072-39079
0.001
2
6mer
29204-29229
0.001
2
6mer
30526-30551
0.001
2
6mer
1699-1709
0.001
2
6mer
12306-12310
0.001
1
6mer
10099-10103
0.001
1
7mer
49431-49441
0.001
1
6mer
11687-11713
0.001
1
6mer
28679-28702
0.001
2
6mer
26258-26262
0.001
3
6mer
12957-12964
0.001
1
6mer
2585-2612
0.001
1
6mer
27194-27203
0.001
1
6mer
3586-3590
0.001
Not Conserved
6mer
38099-38122
0.001
4
6mer
47352-47372
0.001
1
6mer
30997-31007
0.001
2
6mer
14595-14599
0.001
2
6mer
29606-29618
0.001
2
6mer
34431-34448
0.001
2
6mer
46544-46554
0.001
2
6mer
15457-15469
0.001
2
6mer
12619-12623
0.001
Not Conserved
6mer
7975-7985
0.001
2
6mer
12748-12758
0.001
1
6mer
46729-46734
0.001
1
6mer
35937-35948
0.001
4
6mer
46405-46415
0.001
2
6mer
22114-22141
0.001
1
6mer
45503-45523
0.001
1
6mer
12432-12442
0.001
1
6mer
47514-47534
0.001
2
6mer
41964-41985
0.001
4
6mer
3714-3724
0.001
1
6mer
12804-12829
0.001
1
6mer
13745-13765
0.001
Not Conserved
RP11-344E13.3
hsa-miR-1302
0.986

Gene Details
Chromosome: 17
Transcript: ENST00000580278
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1612-1618
0.062
1
7mer
866-881
0.008
1
6mer
109-126
0.005
1
7mer
914-926
0.004
1
6mer
942-946
0.002
1
GLIDR
hsa-miR-1302
0.986

Gene Details
Chromosome: 9
Transcript: ENST00000305709
Biotype: lincRNA
Gene id: ENSG00000170161
Gene Name: GLIDR
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
128-152
0.053
1
7mer
2112-2137
0.017
1
6mer
277-298
0.006
1
6mer
186-201
0.003
1
AC010226.4
hsa-miR-1302
0.985

Gene Details
Chromosome: 5
Transcript: ENST00000515570
Biotype: antisense
Gene id: ENSG00000249249
Gene Name: AC010226.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
651-669
0.076
6
6mer
258-262
0.003
2
RP11-120K24.3
hsa-miR-1302
0.985

Gene Details
Chromosome: 13
Transcript: ENST00000602192
Biotype: lincRNA
Gene id: ENSG00000267868
Gene Name: RP11-120K24.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1036-1049
0.048
4
7mer
1050-1067
0.023
3
7mer
402-426
0.008
2
Funded by: