Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_005882
hsa-miR-1302
0.985

Gene Details
Chromosome: chr6
Transcript: TCONS_00012335
Biotype: transcript isomorph
Gene id: XLOC_005882
Gene Name: XLOC_005882
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
70-89
0.079
1
XLOC_002900
hsa-miR-1302
0.985

Gene Details
Chromosome: chr3
Transcript: TCONS_00006294
Biotype: transcript isomorph
Gene id: XLOC_002900
Gene Name: XLOC_002900
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2582-2598
0.072
2
6mer
77-93
0.003
2
6mer
1737-1750
0.002
2
7mer
1828-1843
0.002
2
XLOC_003798
hsa-miR-1302
0.984

Gene Details
Chromosome: chr4
Transcript: TCONS_00008352
Biotype: transcript isomorph
Gene id: XLOC_003798
Gene Name: XLOC_003798
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
113-124
0.067
2
6mer
212-234
0.011
2
RP1-309I22.2
hsa-miR-1302
0.984

Gene Details
Chromosome: 22
Transcript: ENST00000624184
Biotype: sense_overlapping
Gene id: ENSG00000279338
Gene Name: RP1-309I22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
19065-19081
0.015
2
9mer
23200-23219
0.010
4
8mer
16263-16283
0.009
6
8mer
14679-14693
0.008
2
6mer
361-377
0.005
5
7mer
1079-1090
0.003
1
6mer
14993-15012
0.002
4
6mer
13154-13169
0.002
2
6mer
26669-26681
0.002
3
6mer
21491-21502
0.002
2
6mer
16075-16091
0.002
2
7mer
2849-2874
0.002
2
6mer
12108-12130
0.002
4
6mer
8591-8617
0.001
2
6mer
25561-25580
0.001
3
6mer
22043-22056
0.001
2
6mer
8258-8284
0.001
2
6mer
7626-7630
0.001
2
6mer
2149-2168
0.001
2
6mer
25371-25375
0.001
2
6mer
15028-15038
0.001
6
6mer
7027-7046
0.001
2
6mer
13337-13341
0.001
1
6mer
8720-8745
0.001
2
6mer
21756-21770
0.001
1
6mer
2969-2980
0.001
2
6mer
16283-16303
0.001
7
AC108488.4
hsa-miR-1302
0.984

Gene Details
Chromosome: 2
Transcript: ENST00000438482
Biotype: lincRNA
Gene id: ENSG00000242282
Gene Name: AC108488.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
791-805
0.034
2
7mer
763-782
0.022
1
7mer
751-770
0.021
1
AC024704.2
hsa-miR-1302
0.981

Gene Details
Chromosome: 2
Transcript: ENST00000435407
Biotype: lincRNA
Gene id: ENSG00000244063
Gene Name: AC024704.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
339-355
0.075
3
RP3-323A16.1
hsa-miR-1302
0.981

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
22333-22348
0.009
2
7mer
32905-32923
0.007
1
6mer
140-165
0.004
2
7mer
46957-46971
0.004
1
7mer
15782-15794
0.004
2
7mer
51897-51918
0.004
2
6mer
442-468
0.003
2
6mer
42159-42169
0.002
2
6mer
1089-1104
0.002
2
7mer
31922-31938
0.002
1
6mer
21350-21363
0.002
2
6mer
19634-19658
0.002
2
6mer
19953-19963
0.002
2
6mer
37625-37652
0.002
2
6mer
11845-11867
0.002
2
6mer
50493-50497
0.002
2
6mer
36720-36740
0.001
2
6mer
3905-3909
0.001
2
6mer
28629-28633
0.001
Not Conserved
6mer
43710-43714
0.001
1
6mer
2434-2442
0.001
1
6mer
8133-8146
0.001
1
6mer
31710-31736
0.001
2
6mer
25231-25246
0.001
2
6mer
18346-18366
0.001
1
6mer
5396-5413
0.001
1
6mer
5073-5088
0.001
1
6mer
3127-3147
0.001
2
6mer
44917-44933
0.001
2
6mer
48068-48095
0.001
2
6mer
28367-28394
0.001
1
6mer
21625-21650
0.001
Not Conserved
6mer
21779-21783
0.001
2
6mer
48806-48830
0.001
Not Conserved
6mer
47060-47078
0.001
2
6mer
21941-21945
0.001
Not Conserved
DEAR
hsa-miR-1302
0.981

Gene Details
Chromosome: 4
Transcript: ENST00000605147
Biotype: antisense
Gene id: ENSG00000270751
Gene Name: DEAR
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
246-256
0.075
5
AP001628.7
hsa-miR-1302
0.979

Gene Details
Chromosome: 21
Transcript: ENST00000420273
Biotype: lincRNA
Gene id: ENSG00000233754
Gene Name: AP001628.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
53-71
0.074
2
LINC00312
hsa-miR-1302
0.979

Gene Details
Chromosome: 3
Transcript: ENST00000442796
Biotype: lincRNA
Gene id: ENSG00000237697
Gene Name: LINC00312
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
925-939
0.037
4
8mer
219-238
0.030
2
7mer
1625-1651
0.006
3
PWRN2
hsa-miR-1302
0.979

Gene Details
Chromosome: 15
Transcript: NR_026647.1
Biotype: lincRNA
Gene id: NR_026647.1 (gene)
Gene Name: PWRN2
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2961-2975
0.037
2
7mer
754-768
0.011
2
7mer
4439-4451
0.010
2
6mer
416-420
0.009
2
6mer
156-160
0.007
1
RP11-539L10.3
hsa-miR-1302
0.979

Gene Details
Chromosome: 4
Transcript: ENST00000515205
Biotype: lincRNA
Gene id: ENSG00000251580
Gene Name: RP11-539L10.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
361-374
0.058
1
6mer
341-360
0.015
2
MIR503HG
hsa-miR-1302
0.977

Gene Details
Chromosome: X
Transcript: ENST00000445415
Biotype: lincRNA
Gene id: ENSG00000223749
Gene Name: MIR503HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
30-56
0.072
5
AC005498.4
hsa-miR-1302
0.976

Gene Details
Chromosome: 19
Transcript: ENST00000592125
Biotype: lincRNA
Gene id: ENSG00000267224
Gene Name: AC005498.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
129-146
0.071
2
RP11-539L10.3
hsa-miR-1302
0.975

Gene Details
Chromosome: 4
Transcript: ENST00000513179
Biotype: lincRNA
Gene id: ENSG00000251580
Gene Name: RP11-539L10.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
352-365
0.057
1
6mer
332-351
0.014
2
XLOC_000782
hsa-miR-1302
0.972

Gene Details
Chromosome: chr1
Transcript: TCONS_00001452
Biotype: transcript isomorph
Gene id: XLOC_000782
Gene Name: XLOC_000782
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2241-2249
0.069
1
RP4-740C4.7
hsa-miR-1302
0.971

Gene Details
Chromosome: 1
Transcript: ENST00000607858
Biotype: sense_intronic
Gene id: ENSG00000272420
Gene Name: RP4-740C4.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
124-129
0.052
1
6mer
454-479
0.016
1
PWRN2
hsa-miR-1302
0.970

Gene Details
Chromosome: 15
Transcript: ENST00000567246
Biotype: lincRNA
Gene id: ENSG00000260551
Gene Name: PWRN2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2963-2977
0.041
2
7mer
756-770
0.011
2
6mer
418-422
0.008
2
6mer
158-162
0.007
1
ERVK3-1
hsa-miR-1302
0.969

Gene Details
Chromosome: 19
Transcript: ENST00000590505
Biotype: retained_intron
Gene id: ENSG00000142396
Gene Name: ERVK3-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3662-3680
0.060
2
6mer
2769-2785
0.004
1
6mer
1865-1882
0.003
1
RP1-20C7.6
hsa-miR-1302
0.969

Gene Details
Chromosome: 6
Transcript: ENST00000607790
Biotype: antisense
Gene id: ENSG00000272223
Gene Name: RP1-20C7.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
236-251
0.067
2
Funded by: