Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC105339.1
hsa-miR-1302
0.969

Gene Details
Chromosome: 15
Transcript: ENST00000440479
Biotype: lincRNA
Gene id: ENSG00000228141
Gene Name: AC105339.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Colon Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2521-2537
0.056
5
6mer
112-132
0.004
2
7mer
1199-1226
0.003
2
6mer
1671-1698
0.002
2
6mer
1206-1226
0.002
3
RP11-538P18.2
hsa-miR-1302
0.968

Gene Details
Chromosome: 3
Transcript: ENST00000475981
Biotype: antisense
Gene id: ENSG00000243150
Gene Name: RP11-538P18.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
337-344
0.041
2
8mer
1415-1421
0.024
2
6mer
115-136
0.002
Not Conserved
CTD-2620I22.3
hsa-miR-1302
0.966

Gene Details
Chromosome: 19
Transcript: ENST00000596769
Biotype: lincRNA
Gene id: ENSG00000267943
Gene Name: CTD-2620I22.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
794-816
0.034
2
8mer
1962-1968
0.011
1
6mer
3909-3929
0.006
2
6mer
3353-3377
0.004
2
6mer
3220-3224
0.004
2
6mer
3405-3409
0.004
2
6mer
2142-2160
0.002
2
LINC00670
hsa-miR-1302
0.965

Gene Details
Chromosome: 17
Transcript: ENST00000313495
Biotype: lincRNA
Gene id: ENSG00000179136
Gene Name: LINC00670
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
116-128
0.051
1
7mer
231-242
0.008
1
7mer
596-609
0.006
2
XLOC_008323
hsa-miR-1302
0.964

Gene Details
Chromosome: chrY
Transcript: TCONS_00017647
Biotype: transcript isomorph
Gene id: XLOC_008323
Gene Name: XLOC_008323
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
160-180
0.064
1
XLOC_013220
hsa-miR-1302
0.963

Gene Details
Chromosome: chr19
Transcript: TCONS_00027180
Biotype: transcript isomorph
Gene id: XLOC_013220
Gene Name: XLOC_013220
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Ovary Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
57-63
0.061
2
6mer
92-110
0.003
1
XLOC_013274
hsa-miR-1302
0.962

Gene Details
Chromosome: chr19
Transcript: TCONS_00027238
Biotype: transcript isomorph
Gene id: XLOC_013274
Gene Name: XLOC_013274
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
230-256
0.012
2
6mer
5949-5975
0.012
2
6mer
291-309
0.011
2
6mer
688-708
0.009
2
6mer
6475-6494
0.007
1
6mer
6283-6302
0.006
1
6mer
3680-3684
0.004
2
6mer
3815-3840
0.003
1
RP11-216M21.7
hsa-miR-1302
0.961

Gene Details
Chromosome: 9
Transcript: ENST00000450520
Biotype: lincRNA
Gene id: ENSG00000233207
Gene Name: RP11-216M21.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2842-2853
0.026
1
6mer
239-248
0.014
1
6mer
1191-1195
0.009
1
6mer
2779-2801
0.008
1
6mer
1608-1625
0.006
1
TSIX
hsa-miR-1302
0.960

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
18910-18925
0.009
2
7mer
18123-18132
0.006
2
6mer
36794-36801
0.006
3
7mer
9902-9920
0.005
1
7mer
29479-29484
0.004
5
7mer
31562-31577
0.004
2
6mer
20665-20688
0.002
4
6mer
761-765
0.002
1
6mer
6163-6167
0.002
3
7mer
34677-34692
0.002
2
7mer
6660-6675
0.002
1
7mer
33830-33850
0.002
3
6mer
33693-33719
0.001
3
6mer
6617-6642
0.001
2
6mer
19053-19071
0.001
2
6mer
4328-4341
0.001
2
6mer
7526-7547
0.001
1
6mer
17305-17322
0.001
2
6mer
7969-7977
0.001
2
6mer
18487-18495
0.001
1
6mer
18628-18632
0.001
2
6mer
1743-1770
0.001
1
6mer
33886-33890
0.001
4
6mer
3525-3540
0.001
1
XLOC_006520
hsa-miR-1302
0.959

Gene Details
Chromosome: chr7
Transcript: TCONS_00014352
Biotype: transcript isomorph
Gene id: XLOC_006520
Gene Name: XLOC_006520
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Ovary Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
316-338
0.062
2
XLOC_008382
hsa-miR-1302
0.957

Gene Details
Chromosome: chr10
Transcript: TCONS_00018121
Biotype: transcript isomorph
Gene id: XLOC_008382
Gene Name: XLOC_008382
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
159-179
0.048
7
7mer
9-27
0.013
2
LINC01088
hsa-miR-1302
0.955

Gene Details
Chromosome: 4
Transcript: ENST00000511895
Biotype: antisense
Gene id: ENSG00000249307
Gene Name: LINC01088
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
20-36
0.053
6
7mer
442-457
0.008
1
CTC-365E16.1
hsa-miR-1302
0.953

Gene Details
Chromosome: 5
Transcript: ENST00000606310
Biotype: lincRNA
Gene id: ENSG00000272093
Gene Name: CTC-365E16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1806-1826
0.015
4
8mer
2080-2102
0.014
1
8mer
767-794
0.011
2
7mer
866-871
0.005
2
6mer
96-121
0.004
2
6mer
1887-1891
0.004
2
6mer
232-258
0.003
1
6mer
409-414
0.003
1
XLOC_007035
hsa-miR-1302
0.951

Gene Details
Chromosome: chr8
Transcript: TCONS_00014956
Biotype: transcript isomorph
Gene id: XLOC_007035
Gene Name: XLOC_007035
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
18995-19019
0.005
Not Conserved
6mer
18919-18936
0.004
Not Conserved
6mer
18844-18863
0.004
Not Conserved
6mer
18546-18560
0.003
Not Conserved
7mer
7332-7357
0.003
1
6mer
18770-18796
0.003
Not Conserved
6mer
18317-18334
0.002
Not Conserved
6mer
18012-18026
0.002
1
6mer
17557-17574
0.002
1
6mer
17034-17057
0.002
1
6mer
4538-4542
0.002
2
6mer
3174-3178
0.002
2
6mer
8399-8403
0.002
1
6mer
1635-1648
0.002
2
6mer
4055-4067
0.002
2
6mer
16729-16755
0.002
1
6mer
10554-10575
0.002
2
6mer
6373-6399
0.002
2
6mer
16039-16060
0.002
1
6mer
17859-17882
0.002
1
6mer
10071-10091
0.001
2
6mer
18241-18258
0.001
Not Conserved
6mer
16426-16450
0.001
1
6mer
12109-12134
0.001
2
6mer
17783-17800
0.001
1
6mer
17333-17350
0.001
1
6mer
10875-10895
0.001
2
6mer
16958-16962
0.001
1
6mer
6191-6216
0.001
1
6mer
17483-17487
0.001
1
6mer
16654-16671
0.001
1
6mer
7190-7202
0.001
1
6mer
17256-17282
0.001
1
RP11-216L13.18
hsa-miR-1302
0.949

Gene Details
Chromosome: 9
Transcript: ENST00000471502
Biotype: retained_intron
Gene id: ENSG00000272679
Gene Name: RP11-216L13.18
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
207-220
0.059
6
RP11-401P9.5
hsa-miR-1302
0.949

Gene Details
Chromosome: 16
Transcript: ENST00000570167
Biotype: antisense
Gene id: ENSG00000260249
Gene Name: RP11-401P9.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
248-267
0.043
1
9mer
3598-3617
0.007
1
7mer
1243-1267
0.004
3
6mer
4292-4310
0.003
3
6mer
3938-3952
0.001
1
6mer
1416-1437
0.001
1
XLOC_011844
hsa-miR-1302
0.949

Gene Details
Chromosome: chr16
Transcript: TCONS_00024531
Biotype: transcript isomorph
Gene id: XLOC_011844
Gene Name: XLOC_011844
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Lymph Node Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
50-71
0.058
1
LINC00494
hsa-miR-1302
0.948

Gene Details
Chromosome: 20
Transcript: ENST00000425021
Biotype: lincRNA
Gene id: ENSG00000235621
Gene Name: LINC00494
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
397-413
0.052
2
6mer
366-374
0.006
3
RP11-435O5.2
hsa-miR-1302
0.948

Gene Details
Chromosome: 9
Transcript: ENST00000433644
Biotype: lincRNA
Gene id: ENSG00000237857
Gene Name: RP11-435O5.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
327-347
0.050
1
7mer
557-568
0.005
2
6mer
672-696
0.003
2
XXbac-BPG154L12.4
hsa-miR-1302
0.947

Gene Details
Chromosome: 6
Transcript: ENST00000425033
Biotype: antisense
Gene id: ENSG00000225914
Gene Name: XXbac-BPG154L12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
163-168
0.053
2
6mer
2335-2351
0.003
1
6mer
1259-1264
0.003
1
Funded by: