Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LL22NC03-86G7.1
hsa-miR-1302
0.946

Gene Details
Chromosome: 22
Transcript: ENST00000458178
Biotype: antisense
Gene id: ENSG00000224086
Gene Name: LL22NC03-86G7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
32905-32923
0.010
10
6mer
27895-27900
0.004
11
7mer
636-654
0.004
2
6mer
36769-36783
0.002
5
7mer
24304-24331
0.002
1
6mer
10067-10086
0.002
1
6mer
16426-16437
0.002
2
6mer
25713-25723
0.002
1
7mer
21685-21706
0.002
2
6mer
34641-34653
0.002
5
6mer
1391-1395
0.002
2
6mer
12911-12924
0.002
2
6mer
9611-9615
0.002
Not Conserved
6mer
14093-14097
0.001
2
6mer
21322-21349
0.001
2
6mer
11079-11105
0.001
1
6mer
11801-11827
0.001
2
6mer
8105-8123
0.001
2
6mer
33618-33622
0.001
2
6mer
30225-30250
0.001
1
7mer
28252-28275
0.001
1
6mer
17893-17914
0.001
2
6mer
29477-29481
0.001
2
6mer
14490-14494
0.001
1
6mer
7197-7210
0.001
1
6mer
1822-1841
0.001
1
6mer
13423-13441
0.001
1
6mer
10195-10211
0.001
2
6mer
15594-15610
0.001
2
6mer
26618-26638
0.001
2
6mer
10261-10286
0.001
2
6mer
12946-12969
0.000
1
XLOC_013490
hsa-miR-1302
0.943

Gene Details
Chromosome: chr20
Transcript: TCONS_00028132
Biotype: transcript isomorph
Gene id: XLOC_013490
Gene Name: XLOC_013490
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
365-388
0.036
1
6mer
451-465
0.011
3
7mer
141-149
0.010
1
XLOC_005139
hsa-miR-1302
0.943

Gene Details
Chromosome: chr6
Transcript: TCONS_00011257
Biotype: transcript isomorph
Gene id: XLOC_005139
Gene Name: XLOC_005139
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
32-44
0.043
1
6mer
143-167
0.014
2
AC009299.3
hsa-miR-1302
0.942

Gene Details
Chromosome: 2
Transcript: ENST00000439050
Biotype: lincRNA
Gene id: ENSG00000227403
Gene Name: AC009299.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2275-2289
0.056
2
XLOC_009584
hsa-miR-1302
0.942

Gene Details
Chromosome: chr11
Transcript: TCONS_00019787
Biotype: transcript isomorph
Gene id: XLOC_009584
Gene Name: XLOC_009584
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
181-200
0.048
3
6mer
67-90
0.008
6
RP6-191P20.4
hsa-miR-1302
0.941

Gene Details
Chromosome: X
Transcript: ENST00000430140
Biotype: antisense
Gene id: ENSG00000236064
Gene Name: RP6-191P20.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1867-1874
0.040
4
6mer
378-382
0.006
5
6mer
1938-1963
0.006
4
6mer
1692-1696
0.004
1
XLOC_006979
hsa-miR-1302
0.938

Gene Details
Chromosome: chr8
Transcript: TCONS_00014506
Biotype: transcript isomorph
Gene id: XLOC_006979
Gene Name: XLOC_006979
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
86-104
0.026
1
8mer
426-448
0.025
1
6mer
1038-1042
0.004
2
XLOC_005763
hsa-miR-1302
0.938

Gene Details
Chromosome: chr6
Transcript: TCONS_00012210
Biotype: transcript isomorph
Gene id: XLOC_005763
Gene Name: XLOC_005763
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
127-150
0.055
2
CTC-529L17.2
hsa-miR-1302
0.938

Gene Details
Chromosome: 5
Transcript: ENST00000503489
Biotype: lincRNA
Gene id: ENSG00000249984
Gene Name: CTC-529L17.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
121-135
0.055
2
CTA-342B11.3
hsa-miR-1302
0.936

Gene Details
Chromosome: 22
Transcript: ENST00000624235
Biotype: lincRNA
Gene id: ENSG00000280370
Gene Name: CTA-342B11.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
24602-24625
0.010
1
7mer
15484-15498
0.004
1
6mer
384-388
0.004
2
6mer
2763-2780
0.002
2
6mer
17088-17112
0.002
2
6mer
12710-12714
0.002
2
6mer
8336-8353
0.002
2
6mer
23693-23706
0.002
Not Conserved
6mer
4681-4707
0.002
2
6mer
6158-6168
0.002
2
6mer
5701-5726
0.002
2
6mer
6550-6570
0.002
2
6mer
7222-7239
0.002
3
6mer
13108-13133
0.001
2
6mer
14950-14954
0.001
2
6mer
9930-9956
0.001
1
6mer
10954-10980
0.001
1
6mer
1613-1633
0.001
2
6mer
15088-15113
0.001
1
6mer
11104-11129
0.001
2
6mer
13243-13269
0.001
2
6mer
21439-21465
0.001
Not Conserved
6mer
15808-15827
0.001
1
6mer
10359-10379
0.001
2
6mer
16007-16017
0.001
1
6mer
18095-18115
0.001
1
6mer
22759-22763
0.001
Not Conserved
6mer
15883-15909
0.001
1
XLOC_007091
hsa-miR-1302
0.935

Gene Details
Chromosome: chr8
Transcript: TCONS_00015017
Biotype: transcript isomorph
Gene id: XLOC_007091
Gene Name: XLOC_007091
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
133-149
0.054
2
XLOC_001924
hsa-miR-1302
0.935

Gene Details
Chromosome: chr2
Transcript: TCONS_00005049
Biotype: transcript isomorph
Gene id: XLOC_001924
Gene Name: XLOC_001924
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
568-572
0.019
2
6mer
467-493
0.018
2
6mer
210-219
0.018
2
RP11-98D18.15
hsa-miR-1302
0.934

Gene Details
Chromosome: 1
Transcript: ENST00000601684
Biotype: antisense
Gene id: ENSG00000269621
Gene Name: RP11-98D18.15
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
454-473
0.054
2
RP11-379I19.1
hsa-miR-1302
0.934

Gene Details
Chromosome: 8
Transcript: ENST00000521456
Biotype: lincRNA
Gene id: ENSG00000253260
Gene Name: RP11-379I19.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
139-155
0.054
2
RP11-378A12.1
hsa-miR-1302
0.934

Gene Details
Chromosome: 8
Transcript: ENST00000618928
Biotype: lincRNA
Gene id: ENSG00000277526
Gene Name: RP11-378A12.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
88-106
0.025
1
8mer
428-450
0.024
1
6mer
1040-1044
0.004
2
RP11-49K24.8
hsa-miR-1302
0.932

Gene Details
Chromosome: 18
Transcript: ENST00000591183
Biotype: antisense
Gene id: ENSG00000267724
Gene Name: RP11-49K24.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1791-1807
0.054
6
TPTEP1
hsa-miR-1302
0.931

Gene Details
Chromosome: 22
Transcript: ENST00000588424
Biotype: lincRNA
Gene id: ENSG00000100181
Gene Name: TPTEP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1252-1269
0.028
1
7mer
1369-1374
0.020
1
6mer
654-668
0.005
1
CTA-221G9.11
hsa-miR-1302
0.931

Gene Details
Chromosome: 22
Transcript: ENST00000623422
Biotype: lincRNA
Gene id: ENSG00000279298
Gene Name: CTA-221G9.11
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
26-46
0.053
1
MIR503HG
hsa-miR-1302
0.931

Gene Details
Chromosome: X
Transcript: ENST00000440570
Biotype: lincRNA
Gene id: ENSG00000223749
Gene Name: MIR503HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
460-486
0.053
5
MIR503HG
hsa-miR-1302
0.929

Gene Details
Chromosome: X
Transcript: ENST00000414769
Biotype: lincRNA
Gene id: ENSG00000223749
Gene Name: MIR503HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
354-380
0.053
5
Funded by: