Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-181B18.1
hsa-miR-1302
0.913

Gene Details
Chromosome: 1
Transcript: ENST00000425754
Biotype: antisense
Gene id: ENSG00000237919
Gene Name: RP11-181B18.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
385-403
0.049
5
XLOC_007104
hsa-miR-1302
0.912

Gene Details
Chromosome: chr8
Transcript: TCONS_00015027
Biotype: transcript isomorph
Gene id: XLOC_007104
Gene Name: XLOC_007104
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
143-161
0.042
2
6mer
366-379
0.007
3
LINC01503
hsa-miR-1302
0.910

Gene Details
Chromosome: 9
Transcript: ENST00000427109
Biotype: lincRNA
Gene id: ENSG00000233901
Gene Name: LINC01503
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
148-161
0.045
5
6mer
435-445
0.003
2
AC010649.1
hsa-miR-1302
0.907

Gene Details
Chromosome: 19
Transcript: ENST00000592230
Biotype: antisense
Gene id: ENSG00000267448
Gene Name: AC010649.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
70-80
0.048
1
RP11-344E13.3
hsa-miR-1302
0.906

Gene Details
Chromosome: 17
Transcript: ENST00000580056
Biotype: antisense
Gene id: ENSG00000233098
Gene Name: RP11-344E13.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
47-62
0.015
1
6mer
471-484
0.011
2
7mer
95-107
0.010
1
6mer
123-127
0.006
1
6mer
364-390
0.006
1
RP11-457M11.7
hsa-miR-1302
0.906

Gene Details
Chromosome: 6
Transcript: ENST00000611708
Biotype: lincRNA
Gene id: ENSG00000275846
Gene Name: RP11-457M11.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1747-1754
0.032
Not Conserved
7mer
2586-2599
0.015
2
XLOC_005213
hsa-miR-1302
0.905

Gene Details
Chromosome: chr6
Transcript: TCONS_00011165
Biotype: transcript isomorph
Gene id: XLOC_005213
Gene Name: XLOC_005213
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Ovary Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1747-1754
0.032
Not Conserved
7mer
2586-2599
0.015
2
AC010649.1
hsa-miR-1302
0.904

Gene Details
Chromosome: 19
Transcript: ENST00000587592
Biotype: antisense
Gene id: ENSG00000267448
Gene Name: AC010649.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
70-80
0.047
1
RP4-803J11.2
hsa-miR-1302
0.902

Gene Details
Chromosome: 1
Transcript: ENST00000418348
Biotype: antisense
Gene id: ENSG00000237481
Gene Name: RP4-803J11.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
488-503
0.047
4
RP11-521O16.2
hsa-miR-1302
0.902

Gene Details
Chromosome: 2
Transcript: ENST00000564121
Biotype: lincRNA
Gene id: ENSG00000260163
Gene Name: RP11-521O16.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3325-3348
0.029
2
8mer
3704-3721
0.012
1
6mer
1364-1382
0.002
2
6mer
2471-2484
0.002
2
6mer
2544-2548
0.001
2
XLOC_013174
hsa-miR-1302
0.902

Gene Details
Chromosome: chr19
Transcript: TCONS_00027635
Biotype: transcript isomorph
Gene id: XLOC_013174
Gene Name: XLOC_013174
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
65-69
0.017
1
6mer
1343-1353
0.016
1
6mer
1204-1219
0.015
1
CTA-243E7.1
hsa-miR-1302
0.902

Gene Details
Chromosome: 22
Transcript: ENST00000623980
Biotype: antisense
Gene id: ENSG00000279110
Gene Name: CTA-243E7.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
11699-11720
0.010
2
7mer
1605-1623
0.005
2
7mer
12677-12700
0.004
1
6mer
12501-12514
0.004
2
6mer
84-102
0.003
2
6mer
175-192
0.003
2
6mer
728-741
0.003
2
6mer
8996-9000
0.003
2
6mer
12773-12790
0.002
1
6mer
4455-4481
0.002
2
6mer
11445-11449
0.002
2
6mer
9586-9605
0.002
2
6mer
5093-5097
0.001
1
6mer
3867-3887
0.001
2
6mer
7103-7113
0.001
2
6mer
6745-6750
0.001
2
RP11-4C20.3
hsa-miR-1302
0.901

Gene Details
Chromosome: 10
Transcript: ENST00000420845
Biotype: lincRNA
Gene id: ENSG00000232259
Gene Name: RP11-4C20.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
615-638
0.043
2
6mer
237-253
0.004
2
ERVH48-1
hsa-miR-1302
0.900

Gene Details
Chromosome: 21
Transcript: ENST00000447535
Biotype: lincRNA
Gene id: ENSG00000233056
Gene Name: ERVH48-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
244-249
0.039
1
6mer
1557-1565
0.007
1
CTA-796E4.5
hsa-miR-1302
0.899

Gene Details
Chromosome: 22
Transcript: ENST00000624243
Biotype: lincRNA
Gene id: ENSG00000280065
Gene Name: CTA-796E4.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
30042-30065
0.012
6
8mer
6676-6691
0.005
1
7mer
17812-17829
0.005
1
7mer
16184-16207
0.002
Not Conserved
6mer
21690-21704
0.002
3
6mer
26781-26796
0.002
3
6mer
7514-7518
0.002
2
6mer
5597-5612
0.002
2
6mer
26333-26344
0.002
2
6mer
1864-1879
0.002
4
6mer
23609-23628
0.002
1
6mer
19137-19141
0.002
1
6mer
12836-12857
0.002
2
6mer
19368-19372
0.001
1
6mer
19785-19796
0.001
2
6mer
2950-2963
0.001
1
6mer
26483-26506
0.001
1
6mer
20689-20707
0.001
2
6mer
3516-3535
0.001
1
6mer
12912-12923
0.001
2
DKFZP434L187
hsa-miR-1302
0.897

Gene Details
Chromosome: 15
Transcript: ENST00000455163
Biotype: lincRNA
Gene id: ENSG00000225930
Gene Name: DKFZP434L187
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
115-128
0.046
2
CTD-2210P24.6
hsa-miR-1302
0.897

Gene Details
Chromosome: 11
Transcript: ENST00000534128
Biotype: lincRNA
Gene id: ENSG00000255447
Gene Name: CTD-2210P24.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
364-379
0.046
Not Conserved
XLOC_005040
hsa-miR-1302
0.896

Gene Details
Chromosome: chr5
Transcript: TCONS_00010520
Biotype: transcript isomorph
Gene id: XLOC_005040
Gene Name: XLOC_005040
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Colon Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
274-290
0.041
2
6mer
49-57
0.005
2
AC010649.1
hsa-miR-1302
0.895

Gene Details
Chromosome: 19
Transcript: ENST00000590698
Biotype: antisense
Gene id: ENSG00000267448
Gene Name: AC010649.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
70-80
0.046
1
AC092669.6
hsa-miR-1302
0.894

Gene Details
Chromosome: 2
Transcript: ENST00000449673
Biotype: lincRNA
Gene id: ENSG00000225815
Gene Name: AC092669.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
554-560
0.046
7
Funded by: