Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1302

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP3-512E2.2
hsa-miR-1302
0.881

Gene Details
Chromosome: 6
Transcript: ENST00000413986
Biotype: antisense
Gene id: ENSG00000226455
Gene Name: RP3-512E2.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
373-391
0.043
4
XLOC_001489
hsa-miR-1302
0.879

Gene Details
Chromosome: chr2
Transcript: TCONS_00002901
Biotype: transcript isomorph
Gene id: XLOC_001489
Gene Name: XLOC_001489
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
788-811
0.013
1
6mer
2362-2387
0.012
2
6mer
573-594
0.008
1
6mer
2228-2254
0.005
1
6mer
1990-2015
0.004
1
XLOC_003870
hsa-miR-1302
0.879

Gene Details
Chromosome: chr4
Transcript: TCONS_00009022
Biotype: transcript isomorph
Gene id: XLOC_003870
Gene Name: XLOC_003870
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
640-653
0.034
1
6mer
620-639
0.009
2
LINC01217
hsa-miR-1302
0.879

Gene Details
Chromosome: 4
Transcript: ENST00000514427
Biotype: sense_intronic
Gene id: ENSG00000251219
Gene Name: LINC01217
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
376-391
0.043
2
FAM74A1
hsa-miR-1302
0.879

Gene Details
Chromosome: 9
Transcript: ENST00000597685
Biotype: lincRNA
Gene id: ENSG00000215112
Gene Name: FAM74A1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
111-128
0.026
1
7mer
79-96
0.011
1
7mer
45-62
0.006
Not Conserved
RP11-73O6.3
hsa-miR-1302
0.879

Gene Details
Chromosome: 6
Transcript: ENST00000614735
Biotype: antisense
Gene id: ENSG00000227678
Gene Name: RP11-73O6.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
779-802
0.043
6
XLOC_009124
hsa-miR-1302
0.878

Gene Details
Chromosome: chr11
Transcript: TCONS_00019298
Biotype: transcript isomorph
Gene id: XLOC_009124
Gene Name: XLOC_009124
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1531-1556
0.015
1
8mer+wobble
42-60
0.012
1
6mer
1988-2000
0.008
6
6mer
288-311
0.004
4
6mer
464-468
0.003
1
6mer
1046-1066
0.001
1
XLOC_001905
hsa-miR-1302
0.878

Gene Details
Chromosome: chr2
Transcript: TCONS_00004058
Biotype: transcript isomorph
Gene id: XLOC_001905
Gene Name: XLOC_001905
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
31-52
0.043
1
RP4-539M6.14
hsa-miR-1302
0.877

Gene Details
Chromosome: 22
Transcript: ENST00000610737
Biotype: antisense
Gene id: ENSG00000181123
Gene Name: RP4-539M6.14
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
58-73
0.038
3
6mer
190-211
0.004
5
AF064858.11
hsa-miR-1302
0.877

Gene Details
Chromosome: 21
Transcript: ENST00000419664
Biotype: lincRNA
Gene id: ENSG00000237721
Gene Name: AF064858.11
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
207-224
0.043
4
AC083949.1
hsa-miR-1302
0.877

Gene Details
Chromosome: 2
Transcript: ENST00000422013
Biotype: antisense
Gene id: ENSG00000224875
Gene Name: AC083949.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
409-429
0.023
Not Conserved
8mer
315-340
0.020
2
RP4-663N10.1
hsa-miR-1302
0.875

Gene Details
Chromosome: 1
Transcript: ENST00000425449
Biotype: antisense
Gene id: ENSG00000228035
Gene Name: RP4-663N10.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1873-1888
0.039
2
6mer
2273-2280
0.004
1
WDR11-AS1
hsa-miR-1302
0.871

Gene Details
Chromosome: 10
Transcript: ENST00000451706
Biotype: antisense
Gene id: ENSG00000227165
Gene Name: WDR11-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
409-435
0.042
1
CTC-360P9.4
hsa-miR-1302
0.870

Gene Details
Chromosome: 19
Transcript: ENST00000590053
Biotype: lincRNA
Gene id: ENSG00000267489
Gene Name: CTC-360P9.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
285-305
0.042
2
XLOC_010279
hsa-miR-1302
0.869

Gene Details
Chromosome: chr12
Transcript: TCONS_00020261
Biotype: transcript isomorph
Gene id: XLOC_010279
Gene Name: XLOC_010279
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2535-2539
0.020
1
6mer
2240-2244
0.013
1
6mer
951-955
0.009
1
LINC01330
hsa-miR-1302
0.869

Gene Details
Chromosome: 3
Transcript: ENST00000459923
Biotype: lincRNA
Gene id: ENSG00000244227
Gene Name: LINC01330
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1302-1322
0.027
3
8mer
1341-1347
0.011
2
6mer
1529-1547
0.004
1
IBA57-AS1
hsa-miR-1302
0.868

Gene Details
Chromosome: 1
Transcript: ENST00000366713
Biotype: lincRNA
Gene id: ENSG00000203684
Gene Name: IBA57-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
321-332
0.037
2
6mer
85-98
0.005
1
XLOC_008331
hsa-miR-1302
0.868

Gene Details
Chromosome: chrY
Transcript: TCONS_00017598
Biotype: transcript isomorph
Gene id: XLOC_008331
Gene Name: XLOC_008331
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
154-177
0.039
Not Conserved
6mer
360-384
0.003
Not Conserved
RP11-523G9.3
hsa-miR-1302
0.868

Gene Details
Chromosome: 3
Transcript: ENST00000608133
Biotype: lincRNA
Gene id: ENSG00000273193
Gene Name: RP11-523G9.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
214-227
0.041
3
CTC-265F19.1
hsa-miR-1302
0.868

Gene Details
Chromosome: 19
Transcript: ENST00000587894
Biotype: sense_intronic
Gene id: ENSG00000267749
Gene Name: CTC-265F19.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1302
Sequence: uugggacauacuuaugcuaaa
MirBase ID: MIMAT0005890
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
350-356
0.025
2
7mer
364-377
0.012
1
6mer
1986-2003
0.004
Not Conserved
Funded by: