Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_012275
hsa-miR-1910-5p
0.806

Gene Details
Chromosome: chr17
Transcript: TCONS_00025457
Biotype: transcript isomorph
Gene id: XLOC_012275
Gene Name: XLOC_012275
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
310-330
0.034
4
FLJ45079
hsa-miR-1910-5p
0.806

Gene Details
Chromosome: 17
Transcript: ENST00000374983
Biotype: lincRNA
Gene id: ENSG00000204283
Gene Name: FLJ45079
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3637-3654
0.018
2
8mer
2767-2792
0.006
2
6mer
4545-4571
0.004
1
6mer
113-127
0.004
1
6mer
1447-1471
0.001
Not Conserved
RP11-234G16.4
hsa-miR-1910-5p
0.805

Gene Details
Chromosome: 10
Transcript: ENST00000617939
Biotype: antisense
Gene id: ENSG00000275327
Gene Name: RP11-234G16.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
173-179
0.034
9
CTA-390C10.9
hsa-miR-1910-5p
0.805

Gene Details
Chromosome: 22
Transcript: ENST00000609964
Biotype: lincRNA
Gene id: ENSG00000272798
Gene Name: CTA-390C10.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
404-429
0.012
1
7mer
228-253
0.008
Not Conserved
7mer
345-370
0.007
Not Conserved
7mer
286-311
0.006
Not Conserved
LINC01435
hsa-miR-1910-5p
0.804

Gene Details
Chromosome: 10
Transcript: ENST00000596263
Biotype: lincRNA
Gene id: ENSG00000229981
Gene Name: LINC01435
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
116-134
0.034
6
LINC00910
hsa-miR-1910-5p
0.803

Gene Details
Chromosome: 17
Transcript: ENST00000592094
Biotype: lincRNA
Gene id: ENSG00000188825
Gene Name: LINC00910
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
792-817
0.034
3
RP3-503A6.2
hsa-miR-1910-5p
0.803

Gene Details
Chromosome: 6
Transcript: ENST00000439844
Biotype: lincRNA
Gene id: ENSG00000236355
Gene Name: RP3-503A6.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
198-211
0.020
3
7mer
351-377
0.013
2
MUC19
hsa-miR-1910-5p
0.802

Gene Details
Chromosome: 12
Transcript: ENST00000474954
Biotype: retained_intron
Gene id: ENSG00000205592
Gene Name: MUC19
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4301-4327
0.016
2
7mer
159-185
0.012
1
6mer
4422-4441
0.003
1
6mer
978-997
0.002
2
LINC01474
hsa-miR-1910-5p
0.802

Gene Details
Chromosome: 9
Transcript: ENST00000453787
Biotype: lincRNA
Gene id: ENSG00000236849
Gene Name: LINC01474
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
433-453
0.034
3
FOXD2-AS1
hsa-miR-1910-5p
0.802

Gene Details
Chromosome: 1
Transcript: ENST00000445551
Biotype: antisense
Gene id: ENSG00000237424
Gene Name: FOXD2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
386-407
0.029
1
8mer
1008-1024
0.003
2
6mer
1646-1663
0.002
2
RP11-802F5.1
hsa-miR-1910-5p
0.802

Gene Details
Chromosome: 11
Transcript: ENST00000527440
Biotype: lincRNA
Gene id: ENSG00000254885
Gene Name: RP11-802F5.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
335-349
0.034
4
RP3-340N1.2
hsa-miR-1910-5p
0.801

Gene Details
Chromosome: 1
Transcript: ENST00000431027
Biotype: lincRNA
Gene id: ENSG00000227066
Gene Name: RP3-340N1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2067-2088
0.022
2
6mer
1479-1490
0.007
2
6mer
1778-1804
0.004
1
AC093627.7
hsa-miR-1910-5p
0.801

Gene Details
Chromosome: 7
Transcript: ENST00000465755
Biotype: lincRNA
Gene id: ENSG00000232325
Gene Name: AC093627.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
31-49
0.033
2
CH507-216K13.2
hsa-miR-1910-5p
0.800

Gene Details
Chromosome: 21
Transcript: ENST00000623370
Biotype: lincRNA
Gene id: ENSG00000279851
Gene Name: CH507-216K13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1829-1855
0.011
1
7mer
311-338
0.009
1
7mer
493-519
0.005
Not Conserved
7mer
1190-1214
0.004
1
6mer
907-918
0.003
1
7mer
1589-1598
0.002
Not Conserved
LINC01474
hsa-miR-1910-5p
0.800

Gene Details
Chromosome: 9
Transcript: ENST00000423171
Biotype: lincRNA
Gene id: ENSG00000236849
Gene Name: LINC01474
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
433-453
0.033
3
HOTAIR
hsa-miR-1910-5p
0.800

Gene Details
Chromosome: 12
Transcript: ENST00000424518
Biotype: antisense
Gene id: ENSG00000228630
Gene Name: HOTAIR
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
74-86
0.023
4
7mer
2233-2255
0.006
2
6mer
1249-1275
0.002
5
7mer
1280-1298
0.002
4
XLOC_009850
hsa-miR-1910-5p
0.800

Gene Details
Chromosome: chr12
Transcript: TCONS_00021193
Biotype: transcript isomorph
Gene id: XLOC_009850
Gene Name: XLOC_009850
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
634-646
0.029
3
6mer
86-96
0.005
3
XLOC_013621
hsa-miR-1910-5p
0.800

Gene Details
Chromosome: chr20
Transcript: TCONS_00028276
Biotype: transcript isomorph
Gene id: XLOC_013621
Gene Name: XLOC_013621
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
171-183
0.018
1
6mer
1390-1413
0.006
3
7mer
1220-1240
0.006
2
6mer
58-79
0.004
1
CTB-113D17.1
hsa-miR-1910-5p
0.799

Gene Details
Chromosome: 7
Transcript: ENST00000609389
Biotype: antisense
Gene id: ENSG00000272568
Gene Name: CTB-113D17.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3419-3436
0.027
3
6mer
2836-2854
0.004
3
6mer
2904-2931
0.002
2
RP11-381O7.3
hsa-miR-1910-5p
0.799

Gene Details
Chromosome: 9
Transcript: ENST00000597935
Biotype: lincRNA
Gene id: ENSG00000182021
Gene Name: RP11-381O7.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2029-2050
0.032
2
6mer
1553-1570
0.001
1
Funded by: