Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-1910-5p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-62N21.1
hsa-miR-1910-5p
0.955

Gene Details
Chromosome: 4
Transcript: ENST00000504357
Biotype: lincRNA
Gene id: ENSG00000248369
Gene Name: RP11-62N21.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
188-213
0.061
2
RP11-266K4.13
hsa-miR-1910-5p
0.954

Gene Details
Chromosome: 12
Transcript: ENST00000611627
Biotype: lincRNA
Gene id: ENSG00000276417
Gene Name: RP11-266K4.13
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
570-591
0.060
2
LINC01128
hsa-miR-1910-5p
0.954

Gene Details
Chromosome: 1
Transcript: ENST00000416570
Biotype: lincRNA
Gene id: ENSG00000228794
Gene Name: LINC01128
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
514-538
0.060
1
HCG24
hsa-miR-1910-5p
0.953

Gene Details
Chromosome: 6
Transcript: ENST00000414398
Biotype: antisense
Gene id: ENSG00000230313
Gene Name: HCG24
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
146-157
0.039
2
7mer
670-681
0.021
3
XLOC_004536
hsa-miR-1910-5p
0.952

Gene Details
Chromosome: chr5
Transcript: TCONS_00010079
Biotype: transcript isomorph
Gene id: XLOC_004536
Gene Name: XLOC_004536
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1070-1086
0.041
10
8mer
841-847
0.018
4
XLOC_004398
hsa-miR-1910-5p
0.949

Gene Details
Chromosome: chr5
Transcript: TCONS_00009973
Biotype: transcript isomorph
Gene id: XLOC_004398
Gene Name: XLOC_004398
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3082-3107
0.053
2
8mer
1472-1483
0.005
1
XLOC_005026
hsa-miR-1910-5p
0.949

Gene Details
Chromosome: chr5
Transcript: TCONS_00010506
Biotype: transcript isomorph
Gene id: XLOC_005026
Gene Name: XLOC_005026
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
736-749
0.027
4
8mer
782-799
0.020
1
8mer
543-556
0.006
2
6mer
614-634
0.006
3
RP11-75L1.1
hsa-miR-1910-5p
0.949

Gene Details
Chromosome: 12
Transcript: ENST00000541404
Biotype: lincRNA
Gene id: ENSG00000256582
Gene Name: RP11-75L1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
227-237
0.058
1
RP4-568C11.4
hsa-miR-1910-5p
0.947

Gene Details
Chromosome: 20
Transcript: ENST00000620459
Biotype: lincRNA
Gene id: ENSG00000274173
Gene Name: RP4-568C11.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
743-770
0.058
1
XLOC_005500
hsa-miR-1910-5p
0.941

Gene Details
Chromosome: chr6
Transcript: TCONS_00011399
Biotype: transcript isomorph
Gene id: XLOC_005500
Gene Name: XLOC_005500
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
411-435
0.042
2
8mer
454-468
0.014
1
LINC00638
hsa-miR-1910-5p
0.941

Gene Details
Chromosome: 14
Transcript: ENST00000555578
Biotype: lincRNA
Gene id: ENSG00000258701
Gene Name: LINC00638
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1216-1234
0.018
2
8mer
1717-1739
0.014
1
7mer
1935-1961
0.012
1
7mer
1302-1322
0.011
2
6mer
1327-1348
0.002
2
LINC01128
hsa-miR-1910-5p
0.941

Gene Details
Chromosome: 1
Transcript: ENST00000425657
Biotype: retained_intron
Gene id: ENSG00000228794
Gene Name: LINC01128
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
761-785
0.056
1
LOC100129917
hsa-miR-1910-5p
0.940

Gene Details
Chromosome: 4
Transcript: NR_036511.1
Biotype: lincRNA
Gene id: NR_036511.1 (gene)
Gene Name: LOC100129917
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
392-413
0.048
2
6mer
848-871
0.008
2
AC008103.4
hsa-miR-1910-5p
0.940

Gene Details
Chromosome: 22
Transcript: ENST00000623570
Biotype: sense_intronic
Gene id: ENSG00000279987
Gene Name: AC008103.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
869-883
0.056
2
ZNF561-AS1
hsa-miR-1910-5p
0.939

Gene Details
Chromosome: 19
Transcript: ENST00000586943
Biotype: retained_intron
Gene id: ENSG00000267106
Gene Name: ZNF561-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2135-2152
0.055
1
RP11-8L2.1
hsa-miR-1910-5p
0.934

Gene Details
Chromosome: 4
Transcript: ENST00000510016
Biotype: antisense
Gene id: ENSG00000250546
Gene Name: RP11-8L2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
64-84
0.042
2
7mer
79-92
0.012
2
LL22NC03-86G7.1
hsa-miR-1910-5p
0.932

Gene Details
Chromosome: 22
Transcript: ENST00000458178
Biotype: antisense
Gene id: ENSG00000224086
Gene Name: LL22NC03-86G7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28856-28880
0.026
11
8mer
15877-15896
0.004
2
8mer
32264-32291
0.004
1
7mer
3285-3310
0.002
1
8mer
32608-32629
0.002
3
8mer+wobble
6823-6843
0.002
1
7mer
36355-36381
0.002
2
8mer
20508-20529
0.001
2
7mer
12554-12577
0.001
2
6mer
1021-1033
0.001
2
7mer
4762-4787
0.001
1
6mer
14796-14810
0.001
1
6mer
9983-10008
0.001
1
6mer
13958-13972
0.001
1
6mer
34646-34668
0.001
4
6mer
8795-8817
0.001
1
6mer
22297-22323
0.001
1
6mer
35506-35532
0.001
1
6mer
18370-18387
0.000
1
TSIX
hsa-miR-1910-5p
0.932

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
36829-36845
0.022
2
7mer
34084-34110
0.012
2
7mer
2230-2250
0.004
2
8mer
11006-11030
0.004
Not Conserved
6mer
26674-26698
0.002
2
6mer
20225-20242
0.002
2
6mer
20592-20615
0.002
3
6mer
34170-34182
0.001
5
6mer
15978-15999
0.001
Not Conserved
6mer
24179-24198
0.001
2
6mer
14386-14401
0.001
Not Conserved
6mer
11079-11092
0.001
1
RP11-340I6.7
hsa-miR-1910-5p
0.931

Gene Details
Chromosome: 7
Transcript: ENST00000600182
Biotype: lincRNA
Gene id: ENSG00000236299
Gene Name: RP11-340I6.7
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
669-688
0.053
1
RP13-554M15.8
hsa-miR-1910-5p
0.931

Gene Details
Chromosome: 12
Transcript: ENST00000613771
Biotype: lincRNA
Gene id: ENSG00000277186
Gene Name: RP13-554M15.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-1910-5p
Sequence: ccaguccugugccugccgccu
MirBase ID: MIMAT0007884
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
572-595
0.053
1
Funded by: